GenePrediction:GLEAN_2524 Details

Name: GLEAN_2524
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1652615..1655046 (+ strand)
Length: 2432
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1652615..1653326 (+ strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_140:1653383..1653515 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_140:1653579..1655046 (+ strand)
Length: 1468
>GLEAN_2524 class=GenePrediction position=GCSC_140:1652615..1655046 (+ strand)
ATGAACGAGCGACTGCCTTCCCTGCCTTTGCCAACACCCGCCCTGCAGGCATATTCGTCGGGCACGGCCTCACCGCGGGT
TAGTTCTATAGCATCGTCTACGAGCTCCAACGCGGACTCGCAGTCATCCTATACCTCGGTTGCCTCGTCCCTCGGGCCCA
AGACGCCGCCCTCCCTCCTTTCGGTCTCCGGGATTAGCACCGGTCACCTCGGCTCGAACGCCATACACACACCTCTAGTT
CAGCCAAACATTGCTGGGTACGAACAATATCAAGCAATGAATCAAGGAGCAGCAGAGATGTACTACCAGCAGTCGCACAT
GCCGAGTGGCCCGGCGCCTCCGCCTCCGCCTGTCAGCTCTGGTGCGCTCGGTCAGTACAACCCGCACCAGCAGCCACCGA
TGATGCAGTCGGGTCATGCTCAGTATGGTAGTCCGTCTCCGTACGGCCAGTACGGCTATACCAATGGCCTGACCTCCCCC
CCGACCGGTGCCCCGAACGTGTCCAACGGCCTAGGCCCGAATCCCCATGTTCTGCCACTCCCGGGTGTTGCTGCGCAACA
GGGTATGCAGGCCAACTACTCGGGCTTTGATACAAGCGGCCAGTTCGCCCCTCCAGGCATGAAGCCCCGTGTTACTGCGA
CCTTGTGGGAAGACGAAGGCAGTCTCTGTTTCCAGGTGGAAGCCCGAGGAATCTGCGTGGCTCGCCGTGAAGGTAAGCTC
CAGCGATTTTCCCGTTTCCTGTTGCTTTTGCTGACCCGACACAAACAGACAACCACATGATCAATGGAACGAAATTGCTG
AACGTAGCTGGCATGACCCGTGGCCGTCGTGATGGCATTCTCAAGAGCGAGAAGGTGCGTCATGTGGTCAAGATCGGTCC
CATGCATCTGAAGGGCGTATGGTATGTGGCCTCCTGTCTTTCCGTGTACCCGTTTTTGTGAAGACGTCTGGCTCACTCGA
CCAGGATCCCGTTTGACCGTGCACTGGATTTCGCCAACAAGGAGAAGATCACCGAACTGCTCTTCCCCCTGTTTGTCCAC
AACATTGCTGCTCTTCTGTACCACCCGACCAACCAGAGCCGGACGAACCAGGTAATGGCTGCGGCTGAGCGCCGGAAGCA
GGAACAGAGCCAGCAGATGCGCAATGGCCAACCACAACCATCCGGCCTGCCGTCTCTGCAGCACCACCAGACCATGGCAC
TTCCCGGCCCGCAGCCGACTCTTCCGTCCCACAACATTGCCACGCCTGGCCGCCCGCAGCTCGACCGGGCGCACACGTTC
CCCACGCCGCCGACCAGCGCATCGGGCGTGATGGGTGGGAGCATGAACTCGTCCGAACCGTTTCAGTGGGCGCAGCAGGG
CGTGAACGGAGCACAAGGTACAAATCCAATGTCAGTCGATACGAGCCTAAGCAACGCACGCTCAATGCCTGCCACTCCAG
CTACGACGCCTCCCGGACCACCGCTGCAGACCATGCAACCGTACCCGCCGTCGACCCAGTCATACGACAACTCGCGCTCT
CTCTACAACACGCAGGCAAACGCACCACCTCCGCACCAGCAGCAGCATCAGCACCAGCACCAGCAGCACACCCCTCAGCA
GCATCCCCAGCATCCCCAGCACCCGCAGACCTATGCGCTTGCTCCCCAGAGCAGCAGCCCGCAAGACCGCACGCTTTACA
GTCACAGTGCTGCTGCTGCCGCTGCCGCTGCTGCCGGCGGCTATGTCAAGAGCGAGATTCCACCGCCGACGAACCGCTCC
TCGGTGGGTGGGCCGTCTGGAAATGAGCCGGTTGACCAGAAGTCGTCCAACGGCATGCTCCAGCACCACGCCGAACAGGC
CTCGCAGTCGGTCGGCCACGCCGTCGCTGAGGACGAGCACGAGCACGAGGCCGAATACACGCATAACAGCACGGCGTATG
ACACCGGCCGCGCGCAGTACAATTACGGACCACCTCAGGTAGCTCCGCTGCCCAGCGACCACCACCCCCATATGTCGCCT
GAGCTGACGGCTTCTGCCAACCACCAGACCAACTCCGGACGCTCGACGCCCCGCAGCGCTGCTGCTTCCCAGGCTTACTA
TGCCCAGCCCGGGTACAACACGCCGCCCCGTGTCGGCTCGACCGCTGCGGCTACACAAGCTTCGAGCAGCCTGTACAATG
TGGTCACGAACGACCGGACCAGCTCCAATGGCGGCGCGTCCAATGATGGGTATGCCCCTTCGGCCGACATGGGCAGTTCT
CTGCAGAATGGCTATGGCAACCCTATCATGAACGGCGCCTCGACCGGGATGAAACGGGGACGCGATGACGAGGATGACAG
GGTCATGGACCTCAAGCGCCGGAAGACGCTTCTCGACTCTTCGATGCCGGCAGTGTATGATGCCACTATGAACCGAGCAG
CGCCCATTGCGACTCAACAACGTCACAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62