GenePrediction:GLEAN_2529 Details

Name: GLEAN_2529
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1686681..1689984 (+ strand)
Length: 3304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1686681..1686858 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_140:1686929..1688565 (+ strand)
Length: 1637
Type: CDS
Source: GLEAN
Position: GCSC_140:1688622..1688809 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_140:1688889..1689984 (+ strand)
Length: 1096
>GLEAN_2529 class=GenePrediction position=GCSC_140:1686681..1689984 (+ strand)
ATGGCAGGCGTCCTGCGCTTCCGTTTCCTGGCAATTGCCATGGTGTTCCACTTGGTCTACATATTCTCTATTTTCGACAT
TTATTTTGTCAGCCCCGTTGTCTCTGGCATGCGACTTTTCCAGCCCGAGAGGCCTGCCGCCGCCAAAGCTCCAGCTGATC
GCCTCGTCCTGTTTGTCGGTAGGCGCTTTTGAGCCCAGACATCCCTCGTTTTCAAGAGCTTTTGTTCCTTGCTCACAATT
TTGTCTAGGCGATGGCTTGCGCGCCGACAAGGCGCTCCAGTCACATCCTGAGCCGTATCCGGAAACGAAAGAGGACTTGA
TCCCACGACCGCTTGCGCCTTTCCTGCGTTCCAGAATCCTCGAGCACGGAACTTTTGGGGTGTCACATACGCGTGTGCCC
ACCGAGTCGCGACCGGGCCACGTTGCCCTCATCGCTGGTCTATACGAAGATGTCTCGGCAGTCACCACTGGCTGGAAGCT
CAACCCAGTTCATTTTGACAGCGTCTTCAACCGCAGTCGCCACACATGGAGCTGGGGTAGTCCGGACATTCTGCCTATGT
TTGAACTGGGCGCCATCCCTGGCAGGGTTGATGCCTTCTCATATGCGGCCGAAGACGAGGACTTCTCGCAAGACGCCACA
CACCTTGACTACTGGGTTTTCGACCATGTCAAGGAGCTTTTTGCTGAGGCTCGCACCAACGAGACTCTGGCTGCCAGCCT
ACACCAGGACAAGATCGTGTTCTTCTTGCATCTGCTGGGCCTAGACACTACGGGCCATGCATACCGTCCCTATTCCAAGG
AGTACCTGAACAACATCAAGGTGGTGGACAAAGGTGTCGAAGAGATAACCGAGCTGATTGAAAGCTTTTACGGCGATGAC
CGCACAGCATTTGTATTCACGGCTGATCATGGCATGAGTGACTGGGGCAGTCACGGCGATGGCCATCCAAACAACACGCG
CACGCCACTGATTGCCTGGGGCTCGGGCGTTGCTGAGCCTCAGTTGTATCCAGCATATGTGGCGACCAAAGGCATGTTTG
AGACGAAGGCGGGTGTCAAATCAAAGAGTGGCACCGGCATGGCGCCAGGCCATGACGAGTACTCGTCTGACTGGAACCTT
GATCATGTGCGCCGCATTGATGTGGAGCAGGCTGATGTGGCCGCTTTGATGGCTTACCTGGCTGGACTTGAGTTTCCGGC
CAATTCGGTAGGCGAGCTTCCTCTCGATTACGTGGCTGCCAGCCTCGAGGAGAAGGCGCGCGCCGCATTACTCAACGTGC
GAGGCGTCTTGGAGATGTACCGCGTCAAAGAGGAGAAGAAAAGCGCATCACAGCTGCGATTTCGGCCCTTCCAGCCCCTG
AGTGACAGTGTGGGTGATACAGAGGGATTGTCGGCTGAGCACCGCATGGCAGATATTGATGGACTGATTAGCACCGGCCA
TTATGAGGAAGCTGTCGAGGAGGCAGCGGCTTTGTTCAAGATTGCCTTGTCTGGTCTGCGGTACCTGCAGACGTACGACT
GGCTTTTCCTGCGTGCGCTCATCACTGTTGGCTACCTGGGCTGGATCGCCTATGCATTGACCACTGTTGTGGATTTACAT
GTATTGGACGAGAAGACAAGGCCGCAAGCATCGCGGAACTTGGCCGGAGCCATCATCTTCTCGGCAGTTCTCTTTGCAAT
GTATGCGTCTTTTGCAGCCTCAAAGTCGCCACTGTCGTATTACGCCTACGCATTCTTTCCTGTCTTCTTTTGGGAGGAAG
TCTATGCCCGGCGAGACAGTCTTGTGGCGGGACGCAAGCAGCTATTTGGACACTTCAACAGTGGCGCCCACTTCGTCTCA
CTCCTCATTAATGTAACGCTGTACATTGCCGTTATCGTTTTCTTGGTAAGCCAAAGGCATGATTCTTCTGCTTCTCTGGA
CGTGAGCTGACATCCCGAAAGGCTCTAGGATACATACACCGTGACATCTTCACGGCCCTTTTTGTGATTGGCGCCTTTTG
GCCTGCCGTGTACGGACTCCCATTCCTACGCCAACACTTCGCTATGGCTGGCTTGTGGTCCTCTTCGTGTCTGGCCATGA
GCACATTTACGCTCCTTCCCGCCATGAAGGTGGAGAACATTGAGCTTATGTGAGTTCGAGCCCAGCTGATGGAGTTGTTG
TTAGTGTGTGTGCCCAAAAACTGACCGATGGTTCTCGCTTTCTCTCAGTCTGCTGGGTGGTTCTCTCATGGTAGCTGTTG
GCATCCTCTATCTCGTGTTTGAAGATGTGATCCTAGCCGACTTCGCGGCAGCGACGGAGGCAAGGTCAGCGTCGTCTGTT
GCTGCAAAGAGTCCTGTCGTGCGAGTCCTGTTGGGTGCCCAGGTTGGATTGATTATTTTATCGATGTGGGTGACGCGGTC
GAGCGCCCTTTCTCTACAGGCCAAGGCAGGCCTTCCTCGGGGCAACCAGGTGGTTGGATGGCTTATTCTGGTCATGTCCT
TGGTCGTGATGCCTATGGCACACAGCGCCGAACCGAACCGCAACTACCTGCACCGTCTAATGGTGATATTCTTGACTTTT
GCGCCCACATTCGTCATTCTAACCATTTCCTACGAGGGCCTATTTTACCTGGCGTTCAGTGCAGTCCTGGTGGCATGGGC
GCGTATGGAGCACGCAGTCCATATCTTCTCAACCCGACCGTTGCTAGCAACACCAAAGGCCAATGGGTCAGGCAAACCGG
TGGCAGCAAGCATAACGACAACGGATAGGACAACGGCACCCTACAGGCCGCTCACACTTGCGGATACTCGGGTAGCCTTA
TTCTTCTTTGTGCTGCTTCAGGCTGCCTTTTTCAGCACTGGCAATGTGGCCTCTATCTCGTCTTTCAGCCTGGACAGTGT
GTACCGGCTGATCCCTGTGTTTGATCCGTTCTCACAAGGGGCGCTACTGGTGGTAAAGCTGTTGGTTCCATTTGCACTCA
TATCGGCCAATCTCGGAATCCTCAACAAGCAGCTTGGCGTGGCACCATCAGCCTTGTTTATGACGGTCATGGCAATCAGT
GATATCCTGACGCTCTATTTCTTCTGGGTTGTCAAGGATGAAGGGTCATGGCTCGAGATCGGCTCCACCATCACGCACTT
TGCTGTCGCCAGTCTGCTCTGTGTCTTTGTGGCGGGACTGGAGGGTGTCAGCGCGCTCTTTATTGCGGGCGTGGAGGTAA
ATGATACGATTCTAAAGCCAGCAAACACAGTAGTAAAGTCGGCATCTGCACGGCCGTCGACCAACGGTCAGTCGCACACG
CCAAAGGTGTCAGGAAATAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62