GenePrediction:GLEAN_2530 Details

Name: GLEAN_2530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1691364..1698338 (+ strand)
Length: 6975
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1691364..1691437 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:1691526..1691595 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:1691767..1691821 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:1691893..1693778 (+ strand)
Length: 1886
Type: CDS
Source: GLEAN
Position: GCSC_140:1693843..1694018 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:1694767..1695188 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_140:1695246..1695420 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_140:1695474..1695670 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_140:1695728..1698034 (+ strand)
Length: 2307
Type: CDS
Source: GLEAN
Position: GCSC_140:1698115..1698338 (+ strand)
Length: 224
>GLEAN_2530 class=GenePrediction position=GCSC_140:1691364..1698338 (+ strand)
ATGCCGCCCGCCATTGCCCGGCCGGGCACTACGATGCTCATGCCGCAACCAAACCAAGACGACATTAATGCTACGTGAGT
CCACGACGGCGAAGCCTTCACGACCATAGCTATGCGGTCTTCTGTGTGATTCTCACGGAAGTGCTGACATTTTGATGTGT
AGGTGGGCGTATCTACAACAAGGCGTCAACAGCATCATGGTTAACATAGATGGAGGAATGACTATGGAGACGGTACGTTC
TTGGCCTGCATTCGCAATTTCCTGCTGCCGAATTTTGACTGACGGATTCCTCCCAGTATATGGGGACATATACGTGAGCA
GCTTGATTCTCTTCCTACATTATCGCATTCTGTACCAATATCTGACCTCGACTAGGGCTATTCACAACTTTTGTACTTCC
CAGAAAGCGGTCGGGCTTCACCAGTCGTCTTCTATAGCGTCTGTTGCGCACAGAGGAGGTAAGCCATATCCTCATTAGCT
TGTGTGGCCCCTGTTATGCAGACCAGTAACTGACTATGTCTTTGTATAGCACATCTGCTTGGAGAAGATTTGTACGAGAA
ATTGACTGATTACCTCACTGGGCATCTCGAAGGTCTCCGCGAAGAGGCGTCTCACCATGGCGGCGAAGCGCTTCTCGCTT
TCTACATACGCGAATGGGATCGATACACTGTCGCCGCGAAGTACATACACCATCTTTTCCGGTACCTGAACCGTCACTGG
GTAAAGCGTGAAATGGATGAGGGCAAGAGGAATGTGTACGATGTCTACACGTTGCATCTTGTTCAATGGCGCAGCATCCT
TTTTGACAAGATCTCCGTTCAAGTCATGAACGCTGTGCTGAAGCTTGTCGAACGACAGAGAAACGGCGAGACGATCGAGT
ACCTGCAGATCAAACAGGTGCTTGACTCGATGGTTTCTCTTGGCCTGGACGACAGCGACTCCAGCAAAACCACACTGGAC
ACATACCGGTACCATTTCGAGCGGCCGTTCTTAGATGCCACCCAGAAATACTACCAGGACGAGAGCAGCCGATTTGTGGC
AGAGAATCCGGTTGTCGAATACATGAAAAAGGCAGAGATTCGGTTGCAAGAGGAGGAGCAGCGCGTGCAGATGTACCTTC
ACCCAGACATAGCAATACCGCTGAAGCGGTGCTGCAACCAGGCGCTCATCGCGGACCACTCAGCCCTTCTGCGGGACGAG
TTCCAGTTTTTGCTGAACAACGACCGCGAAGAGGACATGGCACGAATGTACAATCTTCTGTCTCGGATACCCGAAGGATT
GGACCCGCTGAGGACACGTTTCGAAGCTCACGTTCGTAATGCTGGTTTGGCCGCCGTGGCCAAGGTGGCTGCGGACACGG
AGAAGCTAGACCCCAAGGTGTATGTCGACGCGCTGCTCGAGACGCACACACAATACCAAGGCTTGGTCAAGCGCGCTTTC
AACGACGAGCCAGAGTTCACACGCTCTCTCGATAACGCGTGCCGCGAGTTTGTGAACCGCAACGATGTCTGCAAGGCGGG
TTCGAACAAGTCTCCAGAGCTCCTGGCCAAATACGCCGATATGCTGCTGAAGAAAAGCGGGACTGGCGTCGAAGAGTCCG
AGTTGGAGGTCACCCTTACCCAGATCATGACCGTTTTCAAGTACATTGAAGACAAGGATGTGTTCCAGAAGTTCTACTCG
CGAATGCTGGCTCGCCGCCTGGTGCACACCAGCACCTCGTCAGACGATGCAGAGACGAGCATGATCAGCAAGCTGAAGGA
GGCGTGTGGCTTTGAGTACACCAACAAGCTGCAGCGCATGTTTCAGGACATGCAAATTTCCAAGGATCTAAATGCCGGGT
TTAAGGAGCACGTGCAGGTCATGGACGGTTCCTCCCTAGACGGCCAATACTCCATTCTAGGCACGGGCTTCTGGCCGCTG
TCCCCCCCCACCACGACGTTCAGCCCGCCAGCGGAGGTGCAGAACGACTGCGACAAGTTTACGCGGTACTACAAGAACAA
GCACGAAGGCCGCAAGCTGACCTGGTTGTGGCAGCTGTGCAAGGGCGAGCTGAAGACGAGCTACTGCAAGAACAGCAAAA
CGCCGTATACATTCCAGGTCTCGGCGTACCAGATGGCCATCCTGATGCTGTTCAACGACAAGGATAAGTACACATACGAG
GAAATTGTGTCGGCAACGCAGCTGAACAGCGAATCTCTCGACCCGAGTCTTTCCATCATCCTCAAGGCCAAGGTACTCCT
TGCATCCCCGGCAGACGGCGACAAGGTCGGGCCTGGCAAGACTTTCAGCCTTAATTATGACTTCCGCAACAAGAAGATCC
GTATCAACCTTAATGTCGGCGTCAAGTCGGAGCAGCGACAAGAAGAGGCCGAGACGAACAAGACGATAGAAGAGGACCGG
AAACTGTTGCTCCAGGTACGTTTGTTCCTTTGTGCCGACCACACATTGACTCCAGCCTGCTGACATGCAATCTCGATAGT
CTGCTATTGTCCGTATCATGAAGGCTCGGAAACGCATGAAGCATGCGCAGCTCGTTAGCGAGACTATCACGCAGATCAAA
GGCCGATTCTTGCCCAAGGTCGCGGACATCAAGAAGTGTATTGAGATCCTGCTGGACAAGGAATATCTCGAACGGCTAGA
CGACGACGAGCTAGGGTACCTTGCCTGAAGGCGAGGCCGCAAGCGCTTCAACGGGACATGCGATTTTCTGATGGGCACTT
GCTGTTCACTCCTCTTTGCTGCATGGCCCTGTCTTCCTGTCACTGGTAACCGCACTTACATATACCGCGGTCTTGTCTAT
CCGTATGAGTAGAAGCATTGATGTGGCAAGCGAAAAAGGCAAAAAGTCTTAACTCAATGTCACTGTATGTATGACCTTAT
CGATAACCCTCATTATTCTCGTGTGTATGCCAGCCTAACTTTTCATGAGAACAATCAACAGATTTGGCTGTCGGATGCTG
GTGGTCAGAGTATATAAAATAGATTGGTGAAGAGAATACGATTGTTGTTGGCATCACGATTGCGAAATGCGCTACTGTAC
GGAGTAGTGAAGTAGCGCGAGAAATGCACTAATGCGACTTATGCGAGGGCAGGGGAAATGTGGGTCTGGGAAAGAGCAGC
TGTATCTTACTCGTAGGCTGGTTGAAAAATTCACAGCTTCAAGGCATTGGCGGTTGAATCCTGCACAGCGGCCAGGGCAT
CATTACCACCCTTGTCGTTTTCTTTTCTACCGCCGTTTGGGTCGAATGTGTATTCGTTTTTTCCCTGTGTGTTCTCGCTG
CACAAGTGAAACTGTCATCAGAGGTAGCTTTTTGCACAGGCGCGTTTGTCGTTGATCCAGCTGGATGAGACATCCGAGGC
TTACGACTCTGTGCAGTGCCTACGGAAGTCTCACTCGACCCAGACTCCCGTTCTCTTCGACTATCCTGACAAAGGGCGCC
ACAGCGCTCTGGAGCACAGGAGTAGCCAGTGCATCGACGCAATACTTTCTTCTGGGCGCATCTGTGCGATTCAGCTCATC
TGCAGCTTCGACTGCGGCTCAGTCCCGAGTTACGGCGGCGATGAACGGTACAGCAGGAGCAGCGGCTCTGGGCAAGCGGA
AGACAGCGCATCCCAGCGACGGCGACCGGCCGTCTAAATTACAGCGGTCTCTGAACGGCGGGACAGCAGACGAGGCAGGC
GACAGCGACGACGTGCCCAACGACGACGCGATGCTGGACGGCGAGGAGGCGAGCGGGGCCGAGGAAGACAGCCTTGGCAG
CGAAGACGGCTTCGAAGACAGCGAGGCGCTGGACGGCAGCAGCGGCCGGGCAGCAAAGCGGCATGGTCACGGCCACAACA
AGCAGCAGCAGCAGCAGCAGCAGCTGCCACTGCTCGGATCAGCGCCACCGCCGGTGGTTCTCGCGTCGGGCGCGGCCGAG
TCAGCCGAGTGGCAGGAGACGATCCAGCGGGTGGTGTGCAATGTGGTATCGATCCGGTTCTGCATGACGTGCTCGTTTGA
TACGGAACCGGCCCTGACCAGCGAGGCGACCGGCTTTGTTGTCGATGCCGAGAGAGGGTGTGTTTGTGTTCCGGTTGTCT
TGGCTAACGCACTGGCTAATCGATGTGTAGATACATCTTGACAAATCGACACGTTGTCGGGTCCGGGCCGTTCTGGGGCT
ACTGCATCTTCGACAACCACGAGGAGGTGGACGCGTATCCGGTGTACCGCGACCCTGTGCACGACTTCGGCATCTTGAAG
TTTGACCCGAAGGCGATCAAGTACATGCCTATTCAGGCTCTGAAGCTGTGTCCCGACCTAGCCAAAGGTGTGTTTGTGGT
TCTGTTCCCGGTCTGACGAAATGTAGCTGACCTGTTCGTGTTAGTGGGTGTGGAAATTCGAGTGGTGGGAAACGATGCGG
GCGAGAAGCTCAGCATTCTTTCGGGCGTCATCAGCCGTCTCGACCGCAACGCGCCGGAATATGGGGACGGATACTGCGAC
TTCAACACGAGCTACTACCAGGCTAGCGCGGCGGCCAGCGGCGGAAGCTCCGGCAGTCCCGTAGTTAACATCGACGGCAA
TGCAGTGGCGCTACAGGCAGGCGGACGAGCGGACGGAGCATCGACGGATTACTTCTTGCCGCTGGACCGGCCGCTGCGGG
CACTGCGTTGCCTGCAGGAGGGCAAGGCGATTGCGCGCGGCGACATTCAGTGCCAGTTTCTGCTGAAACCGTTTGACGAG
TGCCGGCGGCTGGGGCTGTCGGCAGACTGCGAGGCAGAGATGCGAGCGGCCTTTCCGACGGAGACGAACATGCTGGTGGC
AGAGATCATCCTTCCGTCAGGGCCATCGCACGGCAAGATTGAAGAGGGCGACGTGCTGGTGCGGGTGAACGGCGAGCTGA
TCACGCAGTTTGTGCGACTGGACGCGATCATGGACTCGCATGTGGACCAGACGGTGCGACTGGAGCTACAGCGCGGCGGC
TCGACGGTGTTGGTGGACGTGACGGTGGGCGACCTGCACAAGATCACACCGGACCGGTTCGTGTCGGTAGCAGGCGGCAG
CTTCCACAACCTGTCGTACCAGCAGGCGCGGCTGTACGGGGTAGCATGCAAGGGCGTGTACGTGTCGGAGGCGTCGGGAT
CGTTCCGGTTCGACAGCAGCGACAACGGGTGGCTGGTGCAGTCGATCGACCACAAGAAGGTGACGGACCTGGACGAGTTT
GTGGAGGCGATCCGGACAGTCCCGGACAAGTCACGGGTGGTGGTGACGTACCAGCACCTGCGCGACCTGCACACAAAGCA
CACGACGATCATCTACGTGGACCGGCACTGGTCGTCCAAGATCCGGCTGGCAGTGCGCAACGACACTACGGGACTGTGGG
ACTTTAGCGACCTGGGCGACGCGCTGCCGGCGGTGGCACCGGTACGACGGACGGCATCGTTCATCCAGCTGAAGCACATG
CCACACACAGCAGTGGCAGACCTGGTGCGCAGCTTCGTGCACGTCAACTGCTACATGCCGCTCAAGCTGGACGGGTTCCC
GAAGAACCGCAAGTGGGGGATGGGGCTGGTGATCGACGCGGCCAAGGGACTGGTGGTGATCTCACGGGCAATTGTGCCAT
ACGATCTATGCGACATCACGGTGACGATTGCGGACTCGATCGTGGTGGAGGGCCGGGTGGTGTTCCTGCACCCGCTGCAG
AACTACGCGATCATCCAGTACGACCCGGCACTGGTGGACGCGCCAGTGATGAGCGCACGGCTGAGCAGCGAGGAGCTCTC
GCAAGGCGCAGCGACCAACTTCATTGGGTACAACCGGATCGGACGGATTGTGCACGCGGCAACGACGGTGACAGAGGTGT
TTGCAGTGGCCATTCCGGCGAACCCAGGCGCACCACGATACCGTGCAGTCAACGTGGACGCGATCACGGTGGACACCAGC
CTCAGCGGCCAGTGTGGCAGTGGCGTGCTGGCAGCAGACGATGGAACGGTGCGAGCGCTGTGGCTGACGTATCTGGGCGA
GCGGTCGCCAGCGACACATCGGGACGAGGAGTACCACCTGGGCCTGGCGACGCCGACGCTGCTGCCGGTCATCGAGCAGA
TCCAGCGTGGCGTGGTGCCGCGACTGCGCATGCTGCCGGTCGAGGTGCGGTCGATTCAGATGTCGCAGGCCCGGCTGATG
GGCGTGTCGGAGGAGGTGATCAGCAAGGTGTCGCTGGCCAACACGGCGCAGCACCAGCTGTTCATGGTGACGAAGCGCAC
GTTCGAGCGGGCGGTCGAGCATGCGGCCGACAGCGGTCTGCTCGAGGGCGATATTCTGCTCTCGCTCAACGGCCGTCTGA
TCACGCGGATCGCCGAGCTGGACGTCATGTACAACCACGACCATCTGGACGCCGTCATCGTGCGCGATTGCGCCGAGATC
AATCTGCGTCTGGCCACCGTCGCTGCCGACGACCACGAGACCGACCGGGCTGTCTCCTTCTGCGGTGCCGTCCTGCATCG
CCCGCATCACGGCGTGCGCCAGCAGATCAGCAAGCTCTTCAGCGAGGTCTACGTCTCGGCGCGCACCCGTGGCTCGCCGG
CTGCCCAGTATGGCCTGGCCCCGACCAACTTTATCACACACGTGAACGGAGAGCCGACACCGGATCTGAACGCCTTCCTG
GCTGCGGTCGTGAAGATTCCGGACAATACATGTGAGTGGATGAATTTTTTGTGTATTTTTTGTGTATTTTTCATATATTT
CAAACCCCACTTACTAACGTCACTTGTCCAGACTTCCGCCTCAAGGCTGTCACCTTTGACAGCATGCCGTGGGTCGTCAC
CATGAAGAAGAATGAACACTACTTTCCCACGGTCGAGTGGATCAAGGACACCGCCGCGCCCTGTGGCTGGCGCCGCGTCA
CGTACGAGGGCGGCGGCAAGGCCGTCGAGGGCGAACCGTCCGAGGGCGTCGTGGTGCCGATTATCGAAGACACCGGCGAC
ATTGCGGCTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62