GenePrediction:GLEAN_2531 Details

Name: GLEAN_2531
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1698842..1703626 (+ strand)
Length: 4785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1698842..1699014 (+ strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_140:1699072..1699162 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_140:1699228..1702899 (+ strand)
Length: 3672
Type: CDS
Source: GLEAN
Position: GCSC_140:1702949..1703626 (+ strand)
Length: 678
>GLEAN_2531 class=GenePrediction position=GCSC_140:1698842..1703626 (+ strand)
ATGGCAATGAGAGGACCGCGTCACCCCATCGGGGCAGCGCCCTGGATCGTGGAGGAGCGCACGACGGCGCTGCACATTGC
CCAATCTGAGACCGAGGAGTTCTCTTTCTCGGTCAAGAACGAGATGGACTGGCTGAACGAGCACATGGCCGAGATCTTTT
CCGAAAACCCAATGTTTGTCGGCCGACAGTCTCGCGACGCACCCGTTCTCCATGCTGACACGTGCTGCAGAAGCGTCGCC
GAGATCTTCAAGACCCCCGGAAAGCTGCGTGGAAAGACACCACGGACAGCACGAACAGTAACCAGGGGGGACATCCGAGC
AGTACGCGCCCTTTCTCCTCGACCCCTCGTCCTGCATCGCGCAGACACCCCGTACTGACATCACAGCCTCTGACGGACGT
CTTTCTGTCCACGCCCAAGGGCCCGCCAAACCCGTTTGCCATCTCCAAGCTCACCGGGATCCAGCAGCAGCAGCGCCGGA
ACTCGCCCACATTCAGGGTCGCCGAGGACCGGCCAACCGGCTCAAGCCCCAGTCCGCGTGTGAGCCCGGCAAAGGTCCGG
CCTTCCGCAAAAACGCCGTCGTCCGTCTTCCGCAAAAACACCTTCCACAGCGCCCAGAAGGCATCCGCGTGTGCAAGAAA
ACCAGAGCCGGCATCGTCGCTCGGAGACTCGGGATATCATGGAAGCCAGGACATGACCGACCAGGACGATGACGACGTGG
ATGTCGATGTCGATGTAGATGTCGATACTGACGATCTTGCCATGTCCAGCACAAGACCGATCTTGCAGCCGACGCGTCAG
GCTGCTTCAGGACCAAAGGCCATCAACGTCCCGACCAGCACCACACCAGCAGCACGAACACCGATACAACCGAGCACAAC
ACCTCTGCTGTTGTCGCCCGACGAAGCTCGTGGCCGCCGCAGTCCCACGCAGCCGGACCACTCGTTCCACTCCGCGAAAG
AAGAGCCCACCGAAGATATGCTACCGCAGGCTGCCGCGTCATCCGGCAGCATCACAGTCTCTTCGTCTCCCTTTGTCCCG
GTGAAGTCCCCCTCTCCGGCTCGTGCCACGATGGCGATGTCACCACAGCGAAAGCCGGCACCACCGCCAATGCAATTGCA
GGACCAGCAAGAGCAGCAAGAGCAGCAGGAACCGTCTTCCCCTCTGGAATCCACCACACCGGCGTTTCCGCCACCCCAAG
AGCTCTTGACTGCTATGGGGCAACTACCTGCCGACGATCCGTTGCTGGCTCCATCAGCACCCACCTCTCCCCTGGTGACG
CCTTCAAAGACGCAAGGCCATGTTGCCATGGAAGACGAGATGGACGTCAATGAACCAGAGGAAGACATGGAAGAGGAAGT
CGAGGTGAAAGCGGAAGCGGAAGCAGAAGACGAGCAGAAGGTGGAAGCATCACAATCTCCAGACTTTGACACAAGTCCTG
TCCGCCCGGTCGTTCGAAAGAGCAGCCTGAACTTCGCGTCTCTGCCGGCACGAGAACCGTTCACATCGAATAAGAGCATT
GGCGGTGCTGCCCGACCGTCACGCACAAGTCACACTGACACAGCCAGAGCTGGCTACTACAACCGTGTCACAGGCGGCAA
GAGTCTCGGCAATGCGCAACCAGCAGAACGGGAAGACGGAGAGAACAACGACCACGACGAGCTGGATGCCGACGATGTCT
TCTCTTCTCATGACGCTATGCAGGCCGACGAGGATGCTACGTCTGACAACAAGACATACACACAGCGTCTGCAGGACCGG
ATCAGCATGTTGGGCAAATCTCAGGCGAGCGGCCCACGGCCCTCCAAGTCGCTGGCTAACCATCTTCCGGGCGCAACGCA
GACCATGCTGTCCGCCTTGGCACAGCCGCAAAGATCGCAGCCCTCTGCCACGTTGTCATCTCCGAAGAAAATCACGAGCC
CGGTCCTGGCGCCTGGCGCTTTCCCGGAAGAGGTCGACGAGGACTGGATCATGCCCCCCCCGGATACTGCTATAACCAGT
CCCCGGCTAAACATGCCGGAAACCTTTGCTTCTGCGGACACAGACGAAGAGCAGGATTTACCAGACAGCCAACCGGACTT
TGTTCTTCCTAAGCAGCGTCAAAGTGCCGTGGCGGCTGCGTCACCCTTGAAGACAAAAGTCATGGCCCTGCGCGAAAACA
GTCCCCGCGTCAATGGGCACATGAAGTCAGCGTCCGTCCCGTCCTTGTCGCTGTTTGCTCCCGACTTGATGGCTGCGCGA
TTGCCTTACCCGACCGACGTCTCTGGCACCGGGCTGTCGGTTGTGACCGACCTGAGAGACCTGCCGTCTTCACCGACAAA
GTCACCTTCCCGCGCATTCCGTGACAGTCCTCTCAGGCAGGTTAAGAGCAAGCTTACCTCGATCATCAAGGGCTCCAAAG
GGCTGCTTGCCAGCAGTGCGGCACTGAGTGCCGAGGGTAAATCGTCGCTTCTGTCTCCTTCCACGCTGCGGCTCGGCATG
AACCTGGCGCCCTCAACAGAGTCCCTGGCTCTACGCCACGGCAGCGTGAGCGTGGACCTTGGCTACCCTGACCTTTCTCG
GCAAATTGCAGCTGCCAAACTGCTTTTTGAAGGCGACTATAACGCAGAACAAGCTGCCACCTCTGCTGAGCCGGAGTCTC
CGGTACGCGTCAGTCCGACTCGTCCCAACATCCGCAAGACCCGGGCTTCAACGGAGCGGGAGCGTCGCGAACAGAAAATC
CGGGAAAAGGAGGAGAAGGAGACCCTGCGAATGGAAGACCGCTTTGAGAAGCTGGAGAAGGAACGCGAAAAGGAACGCGA
GAAAGCGCGAATCTTTAGCGAAGAGAAGGCGGCACAGCAGGAGCAGCTTCAAAAGCAGGCGCAGCTGCAGCAGTCGGCAC
AAAATGACGACGACGAGCTGAACGCAGACGACTACACGCAGCGGCAGCCTGCTGTCCAGGACCAGCAAAAGCCGGCAAGC
TCTCCGTCTCGCGCTCCTGCGAAGCCGGCAAAGCCCAGTCCACGAAAGGCCAAGACGCAACATCTGGAGCCTGATGCAGA
TACGGAAGATCCATCTCAAAACACGCGCCCTCATGCCCATAGCACAGTCCTGGCAAACGCATCCGTCCCTCGGTCAGCCC
AGGCCAAGCGCACGATCCGGCGTCCTATCAAGCCTACAAAGGAAGCGCCCTCGAAAGCCAAGCAGGCGCCGACTGTCATC
CGCGTCAACACATCCAGCTCGCAGCAGCAGTCACAGTTCCACCCGTCGAACAGCGCGCTTGCTGCAACGCCGCATGAAAC
TCTCACGGGGCCGCAGCAGTCGCAGTCGCAGTCGCAGTCGCAGTCGCAATCGCAATCGCATCAGCTCAAGAGCAAGGCTA
GCGCGGCGTCGCTGCACACGAAACCGTCCCTGCAGAGCCTCAAGAGCTCGGTGTCCAGCACCGGCCGGCCCAAAGCATTG
GACCTCGCAGCACGGCGGAAAGAGCAAGAGGAGCGAGAGGCGCAGCGCAAGCGTGACTACAAGGCAGAGCTGGAGAGGAA
GAGGGCAGCCAACCAGGAGCAGGAAGAACAGCGGCGGCTCGACCAACAAAAGGAGCGGGAGGCCGAGATGGCCCGGAAGG
CAGCAGCGGCAGCACAACTGAGACAGGCAGCCATCGAGAAGGCCAAGCAGACACGAGCACCGCCGCCAGCACCGCGAACA
CAGCTACCGAGCGGGCCGTCAGACTATGGGCGAAGCGAGACCGCCGGTCAGCAGCCATCGCGACCGCAATCTCGACTGGC
CACGGCAACCTCGGGGCATCGTTCTCAGGACGAGGCACATCGGCCGGTGAATGCGGCTCTTTCCAACGCAGGCAAGTCCC
TGTCGAAACGGCCATTGCCTGCCACGGATCACACCCAGGCCCACGGCAGATCTGTGACGGCCAACAGTGGCAATGCTGCG
GCATACCAGGCCAAGGAGGCCAAGAGAATTCGGCTGAGCGAGGAGTTCGACGAGGATGAGCTCGAAATGGGAGGCCATAT
CCCGCGTGTGTCCAGCATCAAGGGACCGCCAGTCCGGCCTTCGGGAGTGTTCAAAAAGGTATGTGCTGATTCTCTTGAGA
GGTGAAGAACACCGGCTGACAAGACAGGATTTGCCAAACAAGTCACTATATGGAAACGGATATGCAACAGCACCGTCGAC
GGCCAACATATCGCGCGACCTCTTCAAGACGACGGTGACATCGCAGCACAACCACCAGATGCGGGCTGGCCACCCGCTGG
ACATGGCACAGGTTTCCAAAGCGACAATCTCGTTTGCACCAAACACCAATGCAGTAGTTTCAGCTTCGGCATCTGCTGCT
TCAGCTTCAGCTGCATCCAACCCCCACAAGACGCCTGCACGACCGGCTGGCGTGCCACTGACAAGCAAGTCTACGGCAAA
GTCGGTTGCACGGTCGTCACCTCGCTATCCCAACGGCGATGGCATCGAACTGCCCGAGATCCAGACGGACGACGAGGACA
GCGACGAGGATAGCAATGTCAACGTAGCACCATGGGCAGACTCGCCCGATCTCCGGAGAGCCTTGATGCAACAGGAGACG
ATGGACCCGATGCAGGTGTTTGGGCCGCCGCGGCCACTGAACATGGAGGAGGTGTTCAGCAAGAGCAAAGACAGGTGGAA
CAAGTTCCGTGCGCGGACCAGCAGTGCCAACTGGAGCGGCACAGACCGTCTGACGGAGGATGACATTAGGAAGGATCTTG
CCGCACGCGACAAGATACGGCGTGAGGGAGGATGGACCTACGAGCTGAACAAGGATATGATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62