GenePrediction:GLEAN_2532 Details

Name: GLEAN_2532
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1705038..1708498 (+ strand)
Length: 3461
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1705038..1705134 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:1705201..1706175 (+ strand)
Length: 975
Type: CDS
Source: GLEAN
Position: GCSC_140:1706529..1708498 (+ strand)
Length: 1970
>GLEAN_2532 class=GenePrediction position=GCSC_140:1705038..1708498 (+ strand)
ATGTCCAAGACAGACTTCAACAGAGATTACTATGCCGACCTGGAGCTGCCTCCGACTGCAGACATTAATGACATCAAGAA
ACAGTTCCGCAGATTGGGTCAGTCTCCATTTCTATTTCCCTTGGCTATCTCGTGCCAGCTCCCCTGCTGATATCAGAGTG
TAGCGATGAAGTACCATCCCGATCGCAACCCTGGCAAAGAAACCGAAGTCAACGCAAAGTTTCAGACCATCCAGGCGGCA
CATGAGATTCTGTCGAATCCTGATCAGAAAATACGGTACGATGCCCACCGCAACCGGAAGTCGGCCAGCCGCTTCCCGAC
CGGCTCGGGTGTCCGAGGAAACCCGTGGCAGGATGTCGCAGGCCAATATCCGACACCGCCTAGACGACCAGGTCAGCCAC
CCACTTCGGCCTTTCGCGGGTACGGCACCTCCTCAGTGCCACGAAACCCCCCACCGGCTTCCGCAGGGGCGTCTGCGCAC
CGATACTCGACCTTTAACCAGCCGCCAACGGCCAAGGCGAGCCGGGACAGTGGCGAGACGCACTACCAAGCTTGGAAGAA
CATGCGCCCGAGTCCAAAGCCGACAAAGACAGGCCAAAGCGCCAGTGCTGCATACGCCGGTCCTGATGCCCGGGCTCATG
GGTTCGGAAACAGGCCAGCTCCCACAGCGGCTTCTAATCCGTCTGCGTCCTCCTCCATGCCCCCACCGCCACCGCGTACA
ACATCTCAGAAGCAAAAGGCCGATGCTTCTTTTGGATCGCGCAGGCCGACGGGCTTCTTTCCCCGGTCTCCCATGGGTGA
CGAGCCTCCGGCGCCAAATACAAGCAACTATTTCACAGGCCGCAACCACAGCTCCAGCTATGAAGAGAGGACCGCTCGCC
AGGGAGGCCAGTCCGGCCGGACTACGCCAACACGAAGCCAGCGTAAAGAGGATTCTCGCTCGGCCGACATCTCAGAAGAT
GCTTATTTTGATACCCGCCAGAGCACACCCTATCAGACCCACGGTGGTGAGAAGTTCAACCCGTTTGACGGTGTGCCGTT
CCCCGATCTGAGCCGGACCAGGAGTCAACGAGGGCCCATGGCACAGGACAAACCATCGTCCCGGCGTCGAAGCTCCAGCC
TGCCTGACGAGTCTGACGGTACGGGGAGGGCGAGCGCAAAAGGGTCTGCCTGGAGTACGGCAGAGACCCCGGGCCGTGAC
AACGCTGGTAGTTCTGGTAGTTCCGAGACTAGCTCTAGTTCCGGAACAAGAACCGGAGCTCGAACAAGAACCGGCCCTGC
ACTTCGACACAAATTCTCATCATCGTCTACTCCCATGCCTCAGTTTGACATGCATTACCGAATGCGACAGGAAGAGGATG
AGCCCCCCACGACGCCAATTGCGAAAGCGGCACGGGAAAATCAACACGAGACTCCTGGTGCGTGACTGTGCTTGTCTGCA
CAACATTCATATCGTTGTTTGGATACTAACGTGGCTGGTCATGTCTTGCAGCCGACACACCGGGTCGAGCTCCTGCATCT
GCGACAGATGGCCCAATATTGTACGCAGCACCACATCCAAAACCACATCCTCCTCCGGCCACTATCACCCCTCTGAAGCC
CCCCCCTCCAGCCAGAGTGGCTGGCGGAAAAAGCGCTGGAGTTCAGCAGCAAACACAACCACCAGAGGACACCCCCATTG
CTTCCAAAATGGAGAAGTCACCATCCGAACTGAGAGCGCCGCACTCAAGGGCGTTTCCAAGTGGAGATGCGGACAGCACG
GGGATCTCGGATTTCGAAAGCAAACAGTTTGAGATCTTGAGAAAGCTTGTCTGCAAAGTCGAAATCTTCGATCCCCACGC
GCACTCTTCCCAGGCACCAGACAATATGGACGAGGATGCTCAGCATAAAAGAAGAAGACGGCAAAGGTTGCCAGACGGCT
ACAGCCTGTCGTCGATCAGCCATGCTGACCCAATCGCTTACTCTAGTTCCAAGTTTTCCTTCGATGGCCAGACGCCGGAC
CCTGCATCGCCCATGACACCCAGCCAGGCACCGCGCCACACGGGGCGTTTTATGAGCAGCAGCGCCGAGGGCATCAACAC
CCGCTTTGTTGCGGAAGAACAGGCGAATGCGGCGTGGAAGTTCAGCGCCGGCAGCTCTGACAGTGGGTCGGGCGACTACT
TGTCTTCGCGAATTCGCCGTTCTCAGTCTGGCAGCCGTGTTGGCCGCCAGTCTCAGTCACCAGGCAAAGATTTCACCGTT
CTAGGCGCAGGCTCTGTTCCCTCGCCTTCGAAGGCGCCTCCGCAGACACCTCCGCGACCACCGCGCCCTCCGCTTGCGGC
GACCGAGACACAGGACACTCAGACAAGTGGAGGTGTCGAGGAGAGCGGCGGATTCAATCCGGAGAAGTGGACCGAGAAGA
TTGGGTTGGAGCATTTTGCTCCTCAGGTGCCTCGCAAGGCTACGCCCACACAATTCTCCATGCGTCCTAACAAAAAGCCG
CGGCCTGTGCGGTCAGCGACCAGGACCTTTGTGGTGGACGAGAGTGATGATTCTACTGCCGCAGGAAGTGACACAGAGCA
GGGCAAGTCATCACAGCCCACAGAAGCTCCCGACGGCGAGTTCGGCAACGGCGAGAGGTTTGCTAGCCCTGTTGCCATGG
AGATTGACTCACCTGGGCCGACAGCTATTCCCGAACGGACTGACAGCCCCAAGGAGAGCACCACGAGCCAAGTGAATGGC
TCGACGAACGGCTCGACGAATGGTTCCACGAACGTCTCCACAAACGGCTCGGCAAACGGTTCAGCAAGCCCTGGAGAAGC
ACAGGCGACTGGGGTGCGAAACATTCCGGTCGAGCCGTCACGGCCGGAATGGAGGGCTGGCGACGTCAAGAAGGCAGCTG
TCGATGCAGCAGCCACTGGCACCACAGTGGGCGGCTCAGAAGACTCGGAGGAGTTTCTCATCAGCCTCGCCGACATGAAG
AAGGTGGAGCCTTTCGCCGAAACAAAGGTCGGTGCTACAGGTAGCGGGCTGGGGTCTTTGAATGACCTGCGGACAACTCT
GCCATTTGAAAGCAAATGTTCGGCCAAGCTACCGATCAAGAAGGCAGATCGAAAGGAGTCTATCAGCCTCCCCAAGGCGC
CGACAGCACCACACCCACCGCCTGCGCTGGCTGTTCCCGGGCTGCAGCCGTCAGGCGGAGCGTGGGAGTTGTATGTGGTG
GAGTTTCGCCACTATATGCAGGCGTGGGCCGAGTTCAACAACCTCTACGTGGACCATTTTCTGGCTCGGCGTCATGCCAT
TGAGAAGCAGCGGCGCGAGGGCAACTTTGCCTGGCTGACAACGATGGGTGACGATGGCATCACGGAGTACCTGGGCTGGA
TGGGCCAAGACGCCGAGATCCGATCGGTGTGGTCTGAGTCGTGTACAGAACACGAGCGGGCCGTCCGCCAGTTTATGGCA
TTCCGGAACCGAATGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62