GenePrediction:GLEAN_2533 Details

Name: GLEAN_2533
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1712621..1713948 (+ strand)
Length: 1328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1712621..1712744 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_140:1712812..1713157 (+ strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_140:1713218..1713346 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:1713414..1713782 (+ strand)
Length: 369
Type: CDS
Source: GLEAN
Position: GCSC_140:1713849..1713948 (+ strand)
Length: 100
>GLEAN_2533 class=GenePrediction position=GCSC_140:1712621..1713948 (+ strand)
ATGGGGGCTTGCATGAGCTCGACGAGTGAGGCGGTGGAGCAGAAGAAGAGAAGCCAGAAGATCGACAAGGACTTGGAAGA
GGACTCGAAGCGGCTACGACGAGAATGCAAAATTCTACTCCTCGGTATGCATATCCTCCATTGTCAAGTTGTTCCGAGCA
GGTTGGGTGCTGACCCGTTGGCTCTGTACAGGCTCCGGCGAGTCGGGCAAATCAACGATTGTCAAGCAGATGAAGATCAT
CCACCTCAAGGGCTACTCAGAAGACGAGCTTTACAGCTATCGGGCGACCGTGTTCAAGAACCTCCTCGAGTGTGCCAAGT
CCGTGATCAACGCCATGCGTGAATTCAACATCGAGCCCCAGACAGAAAACATCCAAGCCTACTGCGTCTTCTTGCTCGAC
TATTCTATCGAGTCTGGTCCCCAACCACACATCGACCCCAAGGTCGGCGATGCGGTTCGGGCGATTTGGGACGATCCCGT
ACGCGAGCAGCTCATGGAGCGGCAAACCGAGTTCTACCTCATGGATTCGGCAGAATAGTACGTGTCACGCGCAGTCTTCG
GTGACGAGGGAACACATGCTAACCCGCCCTAACACAGCTTTTTCCAAGAGGCCATGCGGATCGTTCGCCCCGACTACACG
CCCAATGAGATGGACGTCCTCCGCGCAAGAACAAAGACAACCGGCATCTACGAGACCCGCTTCCAGATGGGCCAGTTGAG
CATACAGTATGTGGCGATACAACTCTCCTCGAGCTCGCCCCTTGTCCATCCAGTACTAATAATGCTTGTACAGTATGTTC
GACGTCGGCGGCCAGAGGAGCGAGCGCAAGAAGTGGATTCACTGCTTCGAAAATGTCACATCCATCATATTCTGCGTCGC
TCTGAGCGAGTACGATCAGGTGCTGCTGGAGGAGAGCAGCCAAAACCGCATGATGGAGAGCCTGCTGTTATTCGACTCGG
TGGTCAATTCCAGGTGGTTCATGCGTACGAGCATTATCCTCTTCCTCAACAAGGTCGACATCTTCAAGCAGAAGCTGGCT
CGCTCGCCGCTGGGGAACTACTTCCCCGACTACTCGGGCGGCAATGATGTCAACAAGGCCGCAAAGTACCTGCTTTGGCG
GTTCAACCAGGTCAACCGAGCCCACTTGAACCTATACCCACAGTAAGTCCTCGTCACTCTGTCTCCGTCCTCTCGGCCGA
AACATGACAGCCTGATTAACAAGTGCAGCTTGACCCAAGCGACGGACACGTCCAACATCCGCCTTGTATTTGCTGCCGTC
AAAGAGACCATCCTCAACAACGCCCTGAAAGACTCTGGCATTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62