GenePrediction:GLEAN_2534 Details

Name: GLEAN_2534
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1715895..1718900 (+ strand)
Length: 3006
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1715895..1716051 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_140:1716125..1716445 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_140:1716496..1716761 (+ strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_140:1716829..1718258 (+ strand)
Length: 1430
Type: CDS
Source: GLEAN
Position: GCSC_140:1718337..1718409 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:1718466..1718900 (+ strand)
Length: 435
>GLEAN_2534 class=GenePrediction position=GCSC_140:1715895..1718900 (+ strand)
ATGGCTTCTGAGCGTCTGCCTACCCGCGAGCGGCGACCGTCAGTGGGCGCTCCTCTCGTCGATATCCAGGGCAGTGTTGG
TCCGACTGGCGTCACTCGGCCCAAGCATCGCCGCACCTTCACCGGTTTTGGTGCCCAAGAGATCAAGAGCGTCGAGGGTA
GCGTCTCTCAAACTTCCTATTCCTAGCCGTGTTTGTTTGCGCATTGCTGACTCCCTGTGTGATGGAACAGCCTCAATCCC
AGAGCCTTTGCGTGCGGCTTGGCTGAAGCACCAGGTCAGCGGCTTCAACACCAAAGATGAGTTTGAGACTGAGCTGGTCC
GCCATGTCGAGACTACGCTAGCCCGCAGTTTATTCAACTGTGACGAGGCCGCTGCCTATTCTGCTACCAGTCTGGCCTTC
CGTGACCGCCTGATCATCGACTGGAACCGAACCCAGCAGCGCCAGGCCTTTGCCGACACCAAGCGCGTTTACTATCTCAG
TCTCGAGTTCCTCATGGGCCGTGCCCTCGACAATGCCATGCTCAACATTGGCCGAAAGGACGTTGCCAAGGGTAAGCTGA
CCACGCTTCTTGACTGCCGGGTTCCAATGCTGACAGAGTAGCCGGTCTCGCTGATCTGGGCTTCCGCATCGAGGATGTCA
TCAAGCAGGAACAAGATGCCGCCTTGGGCAACGGCGGTTTGGGTCGTCTGGCCGCCTGCTTCCTCGACAGTCTAGCCTCC
CTCAATTACCCAGCCTGGGGCTACGGTCTTCGCTACCGCTATGGTATCTTCAAGCAGGAAATCATCGACGGCTACCAGGT
CGAGGTGCCTGACTACTGGCTCGACTTCAACCCATGGGAGTTCCCCCGCCACGACGTCACAGTCGATGTAAGCCTTCTCC
CGACAACACCCATCCAGGAAGACTGGACAAGAGCTGACCGCTTTTATTTTGCAGATCCAATTCTACGGCCACGTCAACAA
GACCACCGACGGGTCAGGCAAGGTGACGGCCCATTGGGAGGGTGGCGACACGGTTCGTGCGGTCGCGTATGATGTGCCTA
TTGCTGGCTTTGATACACCCTCTACCAACAACTTGCGCCTGTGGTCCAGCAAAGCGGCGAGCGGCGAGTTTGACTTCCAG
AAATTCAACAACGGCGAGTACGAGAGCTCCGTCGCCGACCAGCAGCGCGCCGAGACCATCAGCGCCGTGCTGTACCCCAA
CGACAACCTCGAACGGGGCAAGGAGCTGCGCCTTAAGCAGCAGTACTTCTGGGTGGCCGCCTCACTCTACGACATCGTGC
GCCGCTTCAAGAAGTCCAAGCGCGCGTGGCGCGAGTTCCCTGACCAGGTGGCTATTCAGCTGAACGACACACACCCGACG
CTGGCGATCGTCGAGCTGCAGCGTATCCTCATCGACATTGAGGGCCTCGACTGGGACGATGCCTGGAACATCGTGACACA
CACGTTTGGCTACACCAACCACACGGTGCTTCCGGAGGCTCTGGAGAAGTGGTCTGTCGGCCTCTTCCAGCACCTGCTGC
CACGCCATCTCCAGATCATCTACGACATCAACCTCTTCTTCCTGCAGCTGGTGGAGCGCAAGTTTCCCAAAGACCGCGAT
ATCTTGCGCCGTGTTTCCATCATTGAGGAGGCCCAGACCAAGATGGTGCGCATGGCCCATCTGGCCATTGTCGGCTCCCA
CAAGGTCAACGGTGTGGCCGAGCTGCACTCGGACCTGATCCGCACCACCATCTTCAAGGACTTCGTCGCCGTCTACGGGC
CCGACAAGTTCATCAACGTGACCAACGGTATCACCCCACGCCGCTGGCTCCACCAGGCCAATCCTGAGTTATCCGCGTTG
ATTGCGAGCAAGATCGGTGCGTCCGACGCCTTCCTCAAGGACCTGACCCTGCTCAGCAAGATCGAGGCGTTTGTCGATGA
CAAGGCCTTCCAGAAGTCTTGGGCCCAGGTCAAGCTCAACAACAAGAAGCGCCTGGCCGATTACATCAAGGAGTCGACCG
GCGTCGTGGTGAACCCGACAGCCCTCTTTGACGTGCAGGTCAAGCGGATCCACGAATACAAGCGCCAGCAGCTAAACATC
TTTGGTGTCATCCACCGCTACCTGACACTCAAGGCTATGACGCCTGAGGAGCGCAAGAAGGTGCTGCCCCGTGTGTCCAT
ATTTGGCGGCAAAGCTGCTCCGGGCTACTGGATGGCCAAGCAGATCATCCACCTGATCAACAATGTCGGCAGTGTGGTGA
ACAACGACGCCGATATTGGCGATGCTCTGAAGGTGCTTTTCCTCGAGGACTATAATGTCAGCAAGGCTGAAATCATCACC
CCGGCTTCAGACCTCAGCGAGCACATCTCCACCGCTGGTACTGAGTGAGTATTCGCCCTACCTTCTACCTGTTGCCCCGC
GACGTACACTGCACATTTGCTTACAATACAATTTTCTGGCAGGGCTTCGGGCACGAGCAACATGAAGTTTGTGCTGAACG
GAGGCCTCATCATCGGTACCTGCGACGGCGCCAACGTAAGTGTCCAGTTTCCATTGTGTAATGCCGAGAGCGACGTGTCC
TAATTGGTCAGATTGAAATCACGCGGGAGATTGGAGAAGAAAACATCTTCCTGTTTGGTAACCTTGCCGAGGACGTCGAG
GACATTCGTCACGCTCACACTTTCGGGGAGCACAAGATCGATCCTACGCTGGAGAAGGTGTTTGAAGCCATTGAGAAGGG
CACATTTGGCAATGCGCAAGACTTCTCTGGCATGATCTCTGCAGTGCGGGAACACGGCGACTACTACCTGGTGTCGGACG
ACTTCAACAGCTACCTCGAGACACAGCAGCTCGTGGATAAATCATACGAAGACCAGGAGAGCTGGGTCAAGAAGTCGATC
CTCAGCGTCGCACGCATGGGCTTTTTCAGCAGCGATCGCTGCATCAACGAATATGCTGAGGAGATCTGGAACATCGAGCC
GCTGGCCGTCGATGCATCGGTGGGCCTGAGCAAGGGTGAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62