GenePrediction:GLEAN_2535 Details

Name: GLEAN_2535
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1720123..1721680 (+ strand)
Length: 1558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1720123..1720178 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_140:1720290..1720337 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:1720413..1720542 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_140:1720612..1720655 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:1720719..1721175 (+ strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_140:1721236..1721314 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:1721379..1721562 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_140:1721623..1721680 (+ strand)
Length: 58
>GLEAN_2535 class=GenePrediction position=GCSC_140:1720123..1721680 (+ strand)
ATGGCCGAGTTTATCCGCACGCAAATATTCGGGACCACGTTCGAGATCACGTCTCGGTGGGTGACCCCATTTTCCTGTCG
GCGCCGTTGCCAGCAGCTAAAAGGCCGCGGCGCTGTTTCTGCAACGCTTCTTCCTGGTACACTAACGGCTTCTTCTTGCT
TGCTCAGATACTCGGATCTCCAGCCGGTCGGCATGGGCGCATTCGGCCTTGTATGGTGCGTTCAACTCCTAGAGGTCAGG
ACTGATCGCCACTACGAAAGGCTGCTAATCTGTCAATGTCCATGTTGCAGCTCCGCCCGTGACCAGCTCACGAACCAGAA
TGTCGCAATCAAAAAGATCATGAAGCCTTTCAGCACACCCGTCCTGGCTAAACGCACGTTCAGAGAGCTGAAGCTGCTCA
AGCATCTGCGACACGAGAACGTATGGTTTCTTTCCACCGTTCTGTATTTGCGTCTTGCTGGACCCCATCTGACTTGACCC
TGTCCGCAGGTCATTTCGCTATCGGACATCTTCATATCGCCCCTGGAGGACATGTACGTGTTTTCTTCTCTCTGCCATGC
GGCCCGCTCGTGTACTAAGACTTGTCTGCTCTCTAGCTATTTCGTCACAGAATTGCTGGGAACCGACCTGCACAGGCTTC
TGACGTCACGGCCTCTCGAGAAGCAGTTCATCCAGTATTTCCTATACCAGATCATGCGCGGCCTGAAATACGTCCACTCG
GCCGGCGTGGTGCACAGAGATCTGAAGCCGAGCAACATCCTGGTGAACGAGAACTGCGACCTGAAGATCTGCGACTTTGG
CCTCGCTCGCATCCAGGACCCGCAGATGACGGGATATGTATCGACGCGCTACTACCGCGCGCCGGAGATCATGCTCACGT
GGCAAAAGTACGATGTTGAGGTCGATATCTGGAGTGCTGGCTGCATCTTCGCGGAGATGCTGGACGGCAAGCCGCTCTTC
CCCGGCAAGGACCACGTCAACCAGTTTTCCATCATCACCGAGCTTCTCGGCACGCCGCCAGATGACGTAATCAACACGAT
TGCTAGTGAGAATGTAAGTGTGCCGCGTATGGGGTTGGAGAGAGCAGGGCATGACTGACGGGGCTGGTGGCAGACGCTGC
GATTTGTCAAGTCGCTCCCCAAGCGCGAACGACAATCGCTGAGAGACCGGTTCAAGAACGCAGAAGACCCAGGTGAGCAC
CGTGCCCAATTTCACTCGTTTGGTCTGCGATAGCCGTCTAACAGGTCATCTGCCAGCCATCGACGTGCTGGAGAAGATGC
TGGTGTTCGATCCAAAGAAGCGAATAACAGCAACGGAAGCCTTGTTACATGAGTATCTGGCGCCCTACCACGACCCAACG
GACGAGCCGGTGGCCGAGGAGAAGTTTGATTGGAGCTTTAACGATGCAGACCTCCCTGTCGATTCGTGGAAGATTATGAT
GTATGCCGAATTTGTTCCTCCGGTAGCCGCTTCTGTATCCGTGGCTGACGTGACGTCTAGGTACTCGGAGATTTTGGACT
ACCATAACATTGAGACGACCGAGCCAGTAGTTACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62