GenePrediction:GLEAN_2537 Details

Name: GLEAN_2537
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1725711..1727477 (+ strand)
Length: 1767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1725711..1726554 (+ strand)
Length: 844
Type: CDS
Source: GLEAN
Position: GCSC_140:1726624..1726880 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_140:1726959..1727477 (+ strand)
Length: 519
>GLEAN_2537 class=GenePrediction position=GCSC_140:1725711..1727477 (+ strand)
ATGAAGAGGAGGCTGAGCCGGGGATTCGGAGACAGCGCGTGTGCAGGCGAGCAGGCAAAGAGGCAGCGGCCACAGACGGC
GGACAAGACGGCGATGGAGCTGAAGATTGAGCTGACAGAGCGGGAGAAGCGGCTGGAGCGTCTGCTGCTGGACGTGGCAG
CGTTTGTGGACGGGGGTGCAGACCGACAGGGGACGCAGCCGCTGGTGCTGCGATGGGCGGGCGGCTGGGTGCGCGACCGG
CTGCTGGGGCGCGAGAGCCACGACATCGACACGGCAATCGACACGATGACGGGCTTTGCGTTTGCGCTCAAGATGCAGGA
GTTTTGCGGGATGGCAGCGAACGCGGCGCGCCACGGCATGGAGCCACGCGACCTGGGCAGCCTGCACAAGGTGGAGGCGA
ACCCGGACAAGAGCAAGCACCTGGAGACGGCGACGGTGCGAATCTTTGATATGGAGGTAGACTTTGTCAACCTGCGACGC
GAGACCTATACGGCTGAGAGCCGCAATCCTCTGGTCGAGTTCGGCACGCCCGAGGAGGACGCGCTGCGCCGCGATGCCAC
CGTCAACGCGCTCTTCTACAACCTCAACTGCGGCACGGTCGAGGACTTCACCGGTGGCGTCGCCGACATGGAGGCCCGCC
TGATCCGGACTCCGCTGCAGCCGCTGCAGACATTCACCGACGACCCGCTGCGCGTCCTGCGGCTGGTCCGGTTTGCTAGC
CGTCTGCAGTTCCGCATCGACCCGGCTGCCGAGGCCGTCATGGCCGACCCGAGCGTGCTGCAGGCGCTGCAGCAGAAGAT
CAGCCGAGAGCGAGTGGGAACGGAGGTGGAAAAGATGTTAAAGGGTGAGTGTGGGAGATATTGTGTTGGGAACGAGAGAG
AGAGAGAGAGAGAGAGAGAGACTGACATCCCAGGAAATCACCCCCGCGATTCACTCCAACTGATCGACCGACTCGGCCTC
TACCACGCCATCTTCACGGATCCAGCACATGCAGACGCCCCCAAGCCGCGGCTGGACGGATGGACGGCCACGTACGAGAC
GCTCAATCACCTGGCCGCGACCACGACACCCGGATCGGTCTACGACGTGCTCGTGCGCACGGAGGAGGCGCAGTACTTTG
CCTGGGTCCTCGCGGCTGCCGTGCCGTGGGACCAGGTGTCGGAGCAGGGTGTCGGAGCAGCATCAGCGGCCAGCAGCAGC
AGCAGCTCGAAGCAGCGGCTGCCATTGGCCACGCTGGCCCTCCGCGAGGGCATACGGGCGCCGAACAAGCTGAGCGACGT
GATCACGGGAGCACATCGTCACCGCGCCGACATTCTAGCGCTCAAGCAGGCCGTCTGCGATGGGGCGCCATGCATGCGCG
AGCGCGATCGCTTTGGCATGGCCATCCGGACGTGGGAGGCGCGTGGCAGCAACTGGAAGCTGCAGGTGCTGTACGCGCTG
CTGTTCGAGGTCCTGACGCTGGCCACGAAGCAGGCAGAGGGAGCCGGCACGGCGGCCGCGTGGACGGCCGAGCGCGACGC
CCTGCTGTGCGGCTGGCAGGCCTTTCTCGACCACCTGCAGGAGCTCGACGTGCTGGACGCGCCGCACATCAAGCGGCTGC
TCGACGGAAAGCAGGTGGCGGCCGCGCTGGCCGTCCGGCCGGGCAAATGGATGGCGGCTGCCATGGACATCTGCATGGCC
TGGCAGCTGCGCCATCCCGGCGAGACCGATCCGGCTGGGGCGATTGAAGAGGTGCGCCGACGCAAGGACGAGATTGGGTT
GAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62