GenePrediction:GLEAN_2539 Details

Name: GLEAN_2539
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1734991..1735525 (+ strand)
Length: 535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1734991..1735346 (+ strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_140:1735420..1735525 (+ strand)
Length: 106
>GLEAN_2539 class=GenePrediction position=GCSC_140:1734991..1735525 (+ strand)
ATGTCAGGAGCCGCGGGTGACAGCCAGCTGTTCGAGGACAGCTTCACGATCACAAACGTGGACCAGTCCAAGTATGATCA
GGTGGCGCGCATCTACGGGACGTCGGCGGACGCGCAGACGGTGATCAGCCTGGACATCAACACGGAGCTGTTTCCGTGCG
TGACGGGCGAGAACCTGACGGTGGTGCTGGCGACGACGCTGTCGCTAGACGGATCGCGGGACGACGACAAGGGCTGGCGC
GACCTGACGAAGCCGGGAGCCGCTGGCGCCGGCGACACGAGCCTGGCCGACATGTACGACTATGTGTGCCACGGCAAGAT
CTACAAGTTTGAGGACGGCGAGGACGGCCAGACGATGTGCGTGGGTGGTGGTTTTTGATCTTGACTGCGGGTGTTTCCCC
AGGGATATTGCTGACGTAATCAATTATAGTAAGGCCTACATCTCGTTTGGCGGCCTGCTGATGTCCTTGGCAGGGCCCTT
CAAGAAGCTGACGCCGCTGCGGGTGGACTACACCTATCTTCTGGTGAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62