GenePrediction:GLEAN_253 Details

Name: GLEAN_253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:553865..555565 (+ strand)
Length: 1701
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:553865..553879 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_167:553955..554050 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:554110..554854 (+ strand)
Length: 745
Type: CDS
Source: GLEAN
Position: GCSC_167:554931..555565 (+ strand)
Length: 635
>GLEAN_253 class=GenePrediction position=GCSC_167:553865..555565 (+ strand)
ATGTGCCGCTTCTTGGTATGCCTTGAGCTCTGTGCGCTTCTGGCAACCGCCTGCAATGCGAACACCATATTCTAACCATA
CTCCTTCTAGGTCTACAAGGGCAGCGACGAGATCCTGCTTTCCAAACTCATCCTCGACCCTACTCATTCCATCCTAAGGC
AATCGTTTGATTCTCGCTTACGGATCGTATGTCCTCCACCGTGTCGTCGCTTCCATGCCTCACTCTTGACTCACCCATTT
TCTAGGACACACGACGTGGTCAGAACAATGCAGATGGTTTCGGCATCGGCTGGTTTACCGACCCCAAGCTTGGAGAGGCC
CCCTGCCTGTTCCGGTCTACGATCCCTGCGTGGAACTGCCCCAATCTCGAGCGCATTGCCACCAAGACGGCGTCTCGCCT
CGTTTTCGCCCACGTGCGCGCAGCTACCGGTTCATCTCTGAGCGAGACCAACTGTCACCCGTTCTCTCATGGCAGTCTGA
TGTGGATGCATAACGGCTCGCTCGGCGGTTGGAAATACATCAAGCGTCGCCTGTCCGAGCGTCTAGCAGACAAGTGGTAC
CATAGCGTCGTGGGCGGCACCGACACCGAATGGGCATTTGCCCTCTTCCTCGACACGCTCGAACGGCTAGGTGCCAGTCC
CAGTTCCCAGCCTGAGAAAGGCTTCGGGCCCGGACTTCTGCGCAAGGCTATGCTGCGCACGATTGCCATTATCAACGAGC
TCATCGACCAGATCCCGGAAAGCACCATCCTGTCGGAGAACGTGGACACCCGGAGCCTGCTCAACTTTGCCCTCTCGGAC
GGTCACAGCGTCATCTGCACTCGTTATGTTAGCAGCACTACCGACCAGGCGGCCAGCCTATATTACTCCTCTGGCAGCCA
GTGGGAGAAGCGTCCGACGGCGGGCGACGACAAGGACTACAAGATGGAGCGGCGGGATAAAGGTGCCGATGTTGTTCTCG
TGGCTAGCGAGCCGCTCACGTTTGAGAGAGGTGGGTTTTGGTGTCGGGACGCTCTGCCGGTGATTTCAGAGAGCCATGTG
ACTAATCCGGTGGTGCTTTGGTACAGAAAACTGGGTCAATGTTCCGACAAACTCTATTCTCACGATTCACGGCCAGACGG
TCATGGTTCACCCAATCCGGGATGCGTACTCTACCCGCGGGCCGGCGCACACGCGGTCAGCAGCCTTTGTGCAGACAAAG
GGACTCGTGGCCAATGAGAAGAACATGCTGCTGCCGAGTCGCATCAGCGGCTCTTTTCCAGCAGCGGTCGCAGGGACAGA
CCAGCACAAGCCAGCGCATGCTTCGTCCATGTCTACGAGCATGTTGCGGGCACGAGTACCCGATGCAACGATCGTCAACC
GGCCCAGAATACCATACTTCTCGTCAACGACCGCCAACAACGTGTCACATCATGCAATGGATTCAAACAACAACTCTACA
TCCACTTCTACAGACGGTCTGCCAGCTGCGTCGGTTCTGGCTTCTCCAGCCCGGCTGTTACCGTCGAAGCAGCCAGCACA
AGGCAATATCAAGAAGAAGCGCATGCTTTTGAGTGAGATGGAGCACACTGCGGTCATGCCTGAGCATGTTGAAGAGCAGC
CGTTGACGCCCACCACACCTGCCGAGCCCCCAAGAAACAACTTTGGAGATCCTCACAAGATAGCCCAATACTTCCCTGAG
CTTAACACCATTACGACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62