GenePrediction:GLEAN_2541 Details

Name: GLEAN_2541
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1742299..1744740 (+ strand)
Length: 2442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1742299..1742313 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1742381..1742421 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1742486..1742554 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:1742609..1742695 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:1743089..1743403 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_140:1743465..1744655 (+ strand)
Length: 1191
Type: CDS
Source: GLEAN
Position: GCSC_140:1744725..1744740 (+ strand)
Length: 16
>GLEAN_2541 class=GenePrediction position=GCSC_140:1742299..1744740 (+ strand)
ATGCCTTCGTACATTGTGAGCAGCTCCTGTCTGACAAGCAATCGCCCGTTTCTTGCGTTTCTAACAATCCATTTCTCCAC
AGATCACCTGCAGGCCAGACGCCTCCAAGGAAGAGGTGGCTGCGTGAGTCCACCTTTCTGTCCTGTCCTCTATTCCACCT
CATCATTCGACTGACTGTCGTCTACAGCGCCAAGAAGACTGCCGTCGAGCAGGGTGGCACCATCGGCCACGAATACGAAC
TGCTCAAGGGTTTCTCGTACGTATTCTCGAGAACAGCCATCTAGCTATCCTGATATCTGACCCGCCACAGTGTCAGCTTT
CCCGACGGAACTGTCAACACCTTGTCTCAGCACCCAAGCATCGCGTCTGTCGATGCCGATCAGGTCGTCAGCACGCAGTA
GACGCTGCCTCTTGACGACTCGCCATAGAAACGGGAATTGCACATTTTCAAGCTCCCAATTCTAAAATAGATCATCTGTC
TTCTGTAACTGCCAACCTGTTGGACTGTTCCTCTCGCCGTGACGTGGTGCTGTGTGTACCTGATTACCCCTCCGTCGCTC
TTGCAGCGTCCGATCGCCCGAGTTCTGACCCCACTTTGTGCGCTGTCACATGTACCCATAGCCGGCATGCTGTATTACCT
AAGAATAGTACGTGCTGGGGAAACAGAGGGGCAGACGTGAAACGAACGAATCAGACAGCCGGAAATCCAAGACGGCTCTT
TGTTCCACCTCGAACAGCTTCTCATCCTTCGTGTCTTTCTTCTCTGCTTCTGACTCACGCACCTCCGTAGCTGTGCCAAG
CACTCAGCACATCGCGATGCCGCCATGAGATGCCTCGTTCGGCCATTGAGGGCTGTTCAGCCCACGGCCACCTTTGTGTC
GAAACGCCATTGTTCTCGCCCTTGCCTTCGTTCTCCCCATCTTCGACTATCGCTTTCTACTGCTCCCCATCATGAACACG
CCCGCGAACATCAGCCACCACCACCACCACCACCACCACCGCATCCAATATCGCACGGCAAAGAGCCGCCACCGCTGCGC
GACCAGGACATCTCCCGTCTTGCTGAGGAGCCGGTGCACCAGCTGCGTCTGGCCGATCTGGTCAAGTATGTCGAGCTAGA
GAGCCTCGCCGAAAGACGACGACCAAATGACTGACTGCACCCACAGACACGGATGGCCCCCTCTCAGCGAAGAGGCCCTG
CTGCAGAGCGCCAACTTCTCGCTCGAACTGATTCCCATCCGCCTCGCTCGTCGGCTGCAGGCCCTGCGCAGTCTGCCCTA
CATCGTCGTGTCCAATCCGCACGTCCGGCAGATCTACGGTAACTATCGCCATAGCCTGCGCTCGCTGCTGCCGCTGTGGC
GTCGTCGTGCCGAGGGCGCCGTCGCGACGCTCGATGACGAGATCGCCTTCACCGAGTCCCTCGCCGATCTCGTTGCCACC
CACCAGAACACCATCCCCTTTCTCGCCCAGGGCTTCCTCGAATGCCGCAAGTACATCTCGCCTGCTCACGTGACCGCCTT
TCTCGACGAGCATCTGCGCGCTCGCATCGGCACCCGTCTCATCGCCGAGCAGCACATCGCCCTGCACCTCAGCAGCCGAC
CTTTTGAGCGGAAGAGCGACACCGGCCCCTCGCCTGCCGCCTCGTCTCTCGACAGCGCCCCCACCGGACAGCCGCCGCCG
TCGTACATCGGCATCATCGACACGCAGCTGCGGCCGGCCCAGACCATTGACAGCTGTGCCGGCTTTGTCGCCGACATCTG
TGAGCTCAACTACGGCGTCCGGCCCGAGTGGCGCATCGACGGCGAGCCCGGCACCACCTTTGCCTACGTGCCCATGCATC
TTGAGTACATTGTCACCGAGCTGCTCAAAAACGCTTTTCGTGCCGTCGTCGAGGGCAACATGTCGCGCGAGCCCATTGTC
ATCACCATTGCGCCCGAACCGCCGAACCGCCTCCGCCCAGAGCGACCGCTGGGACCGGACAATGACGGTATCATCGGCGA
CGGCAACAGCCCTGCCGCCATACTGCCGCTCGACGAAAATGCGCCTGGCGTGACTATCCGCATCCGCGACCGCGGCGGCG
GTATTAGTCCCGAAGTGCTGCCCAACATCTGGTCATACTCTTTCACGACCTTCTCCGACGCCGCCCAGGCCTCGACTGAT
GACGGCGGCTTCGGCTCCGACGGACTTGACATCATCTCGTCCGCCAACAACGGCGGCAGCTCCATTGCCGGCCTCGGCTA
CGGATTGCCGCTCAGCCGGGCATATGCAGAGTTTTTCGGCGGCGGCATCGACGTCCAGAGTCTGTACGGTTGGGGTACCG
ATGTCTATTTACGGCTAAAGGGTGTTGGAAGCATCGGGTGAGTTTTCTTTCATATGCATCACCTGCCCATTTTATTCGTT
CCTGATGACGGATAATGTCCTGACAGGGACAGCAACAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62