GenePrediction:GLEAN_2542 Details

Name: GLEAN_2542
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1754735..1760482 (+ strand)
Length: 5748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1754735..1755048 (+ strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_140:1755185..1760376 (+ strand)
Length: 5192
Type: CDS
Source: GLEAN
Position: GCSC_140:1760451..1760482 (+ strand)
Length: 32
>GLEAN_2542 class=GenePrediction position=GCSC_140:1754735..1760482 (+ strand)
ATGAGCCTCAACCCTCTCGGCGGCGGCGGCACTGGCAGCGGCGGTGCTCATACGCAGCCGTCGCTACCGTCGTTGCCAGC
CCATCTCCAGTCGGATACACATCTAACTGCACACCTCGCCAGCCGCTTCCATGTCTCGCTGCCAACAGCCCGCCTCTCAT
CCCATGCATTGATTTCTCTGAACACATACTCGTCCTCAACCGCCGGTGCTGATGGAGGAAAAGAAGGCAGCGCCTCAGCT
GGCGCTGAAGACATGGCAGAGCGTGCATACATCCGTCTCGGCCATCGTTCTGAAAACCAGGCCATACTGTTCCTGTAAGT
TCCCAAGAAACCTTGTCTTGCTGCCCGGTGGTTGATATACTAATGCAATCTCTTCGCCCAGTGGTGAGTCTGGCTCTGGC
AAGAGCACCATTCGCTCTCACATTCTCGCGGCCCTTTTGCGCAAGTCGAGCACGCCGCTATCCAACAAAGTCTCTTTGGC
CGCCTATGTCTTTGATACTCTGACAACCACCAAAACGGCCACTACTCCAACTGCCTCCAAGGCTGGCCTCTTCTACGAGT
TACAATACGATACATCATCCAGCACCAACCCGTTGCTGCTGGGTGCCAAACTGCTAGATCACCGACTGGAACGTAGCCGC
ATAGCTGATGTTCCCACGGGCGAACGTAACTTCCACATTCTGTACTACCTCCTCGCCGGCACGAGCGCCGCAGAAAAGAA
CCATCTAGGCCTCGAAGATGCTCACACTGGTGCTCAGCAGCGCTGGAAGTATCTTGGCCATCCGACCCAGCTCAAGGTCG
GGATCAACGATGCTGAGGGCTTCCAGCTGTTCAAGACCGCTCTGCGCAAGCTGGAGTTCCCCCGGACTGAAATTGCAGAG
ATTTGCCAGATTCTCGCTGGTATTCTTCACATCGGGCAGCTAGAGTTCGATACCACGTCTAGCACCAGCGTCATGGGCAA
TGATAGTGGTGGATTTTCCCACGAGGGTTCCCAGACTGTCATCACAGTCAAGAACAAGGATGTGCTGGCCATTATTGCCG
CATTTCTCGGTGTCAGTTCACAGGACCTGCAGGCTACTCTCGGCTACAAAACCAAGATGATTCACAAGGAACGGGTCACT
GTCATGCTTGACACCGTTGGTGCTCGCAGCAACGCCGATGAACTCGCCCGGACGTTGTACTCGCTTCTTGTTGCTTATGT
CATTGAAAAGATCAACCAGAAGATCTGTGCTCCTGAGGAGGCCATTGCAAACACCGTCTCCATTATCGATTTTCCCGGCT
TCGCACAGCAGACGTCCACTGGGTCCGCTCTTGACCAGTTGCTCAACAACGCGGCCACTGAGTCGCTGTACAACCTGACG
TTGCAGAACTTCTTCGACCGGAAGGCTGACATGCTAGAGACCGAAGAAGTTAGTGTTGCCGCCACAAGCTACTTCGATAA
CTCAGATGCCGTAAAGGGCCTTTTGAAGCCTGGGAATGGCTTGCTGAGCATCCTGGATGACCAGACACGGCGCCACCGCA
CCGATATGCAGTTGCTAGATAGTCTTCGCAAGCGCTTCGAAGGCAAGAACCCAGCGATCGCGGTGAGCTCTGCTACCGCC
AAACTGCCTGGCAGCAACTTCCTGACCGAGAACACATCGGCAACATTCACCGTCAAGCACTTTGCCGGCGAGGTTGAGTA
CCCTGTGAGGGGTCTGATAGAAGAAAACGGCGAGGTGATCTCTGGCGATTTGCTCAACCTCATCAACTCGACCAAGAGCG
AATTTGTCGCCCGTCTCTTTGGCCAGGAAGCCCTGCAGACCATTGTTCACCCACAGGAGCGGTCTACGGTCATGCAGGCA
TCTGTCAGCTCCAAGCCCATGCGCACGCCAAGCGTCATGTCGCGCAAGGGTCGTGGAGCCCCTCGGCGCCGACAAGAAGC
TGCACTGCGGCAGAAGGAATCTCTCGATGACATTGCCAGCGAAGCCGGTGCCCCTGCTGCCTCAGAGTCACGTCGCGGAG
CGCCACGCGCCCCTTCCGAACAAGGTGCCTCTGGCCAGTTTCTGGCCTCTCTAGACAATGTCACCAAGTCATTCACGGGT
CCCAACACAAATGCTTACTTTGTGTTCTGTCTTAAGCCGAACGACAGACGTATCGCCAACCAGTTCGACAGCAAGTGTGT
TCGCGCACAGGTGCAAACTTTTGGAATTGCCGAGATCAGCCAGCGGCTGCGCTCGGCTGATTTTAGCTTGTTCCTACCCT
TTGGCGAATTCCTGGGTCTTGCCAGTTCCGATATGCTACTGGTCGGCAGTGAGCGTGAGAAGGCCGAGGGTGTCATCGAG
GAGAAGCGGTGGCCGAGCAATGAGGTCCAGGTCGGAGCCACAGGTGTCTTCATCAGCGAGCGTTGTTGGATGGAGATAGC
TCAGCTTGAGACCGGCTTAATGTCTGCTCGTTACGGTGTGCCCTCTGATGCCGGTGACGGCTCGAGCGCTGATCCATTTG
GCGCTTCAAAGGAGCACCTGATCTCTTCATCCAACACTCCTTCCGCCATCGGTGGAGACAAAAACCGTGCTGGCTACTTT
GGCAGCAACGACATCGACGCACGGTCCGAGGCCGGGGCGTCTGCCTTTGGTGCTGGCGACATGTTCAAGAATCTGGACAC
CCGCGAACAGATGGCTGAGCGTGGCAATGAAAAGACCATGGAGGAGGTGGAAGAGTTCAAGGACTCGCCTTCACGAAAGC
GCTGGGTTGCCATGGTCTATATGCTGACCTTTTTCGTTCCCGATTTTCTCATCCGCATCATTGGTCGCATGCCGCGGAAG
GATGTACGCCAGGCTTGGCGTGAGAAGCTTGCTATCAACATGCTCATTTGGTTTAGCTGCTGCCTTGCAGCCTTCATCCT
GGTGGTTTTCCCTCTCATCATTTGCCCGACCCAACATGTCTTCAGCGCGTCGGAGCTGGCCAACCACAATGGCAAGAAAT
CACACGCGTACGTTGCCATCAGAGGGCAGGTTTTCGATCTCACTGCTTTCCAGCCGACGCATTATCCCACCTACCTCTCC
TCGAAGCTGCTCCTCAATTATGGTGGCAAAGATATTACCGCCTTGTTCCCCGTCCAGGTGTCCGCCTTGTGCGAGGGTGT
GAGTGGTACTGGAATCAACCCGGAGGTCACACTGGATTTCACCAACACAAACTACACGGATTCCAGCACAACTACCAGCA
CGGACTACAACGCCCAGTACCACGATTTCCGCTATTTCCAAAATGATACCCGTGACGACTGGTTCTCGGAGCAGATGATC
ATGCTTCGTTCCAACTACAAAAAGGGCAACGTCGGTTACACAGCAAAGTATGTGGGAACCCTGGCGAAGAAGTCCAAGTC
CATTGGCATTCTTAGCGGTCGCATCTATGACTTGACCAACTACGTCGCTGGCGGCCGACAGCTCCTCACGAAAGCCGGGG
ATACGATCACGGGCACGTCCAGCGATCTCAACTTTATGAGCCAGCTCGTTGTAGATCTGTTCCAGCAGAAGTCTGGTAAA
GATATCACGAAGTACTGGAACGCCCTGTCTTTGACAAACGTGCAAAAGTCACAGATGAAGCTCTGTCTGGACAACCTGTT
CTACGTGGGCGATGTCGACACGCGAAACTCGACCCGCTGCAAGTTTGCAACGTACTTCACGCTGGCGATTTCGATCGTCC
TTTGCTCTGTCATTTTCTTCAAGTTTGCCGCCGCGCTGCAGTTCGGCTCGAGAAACATGCCTGAGAACCTCGACAAGTTC
ATCATGATCCAGATCCCTGCGTACACGGAAGACGAGGACTCGCTGCATCGTGCCATTGACTCGGTGGCGCGCATGCGCTA
CGACGACAAGCGCAAGCTGTTGTGTATCCTCTGCGACGGCATGATCATCGGTCAGGGCAACGACCGACCAACACCGCGTA
TTGTGCTCGACATTTTGGGCGTGTCCGACACTGTCGACCCAGAGCCGCTCAGCTTCGAGTCGCTAGGCGAGGGCCAGAAG
CAACACAACATGGGCAAAGTCTATTCGGGTCTGTACGAAGTCCAGGGCCACATCGTTCCCTTCCTGGTCATTGTCAAGGT
TGGCAAGCCGTCCGAAGTGTCTCGGCCGGGCAACCGTGGCAAGCGTGACTCGCAGATGATCCTGATGCGCTTCCTCAACC
GCGTGCACTACAACCTGTCTATGAGCCCGCTCGAGCTGGAGATGTACCACCAAATCCGCAACATTATCGGAGTGAATCCT
ACGTTTTACGAGTTTATGCTGCAGATTGATGCCGATACCGTTGTCGCGCCCGATTCGGCCTCGCGTTTTGTCTCGTCCTT
TATCAACGACACGAACCTGATTGCCGTCTGTGGTGAAACGGCTCTGACGAATGCAAAGTCCTCGTTTGTCACTATGATCC
AGGTGTACGAGTACTACATCTCGCACAATCTGTCAAAGGCGTTCGAATCCCTGTTCGGCTCTGTTACCTGTCTTCCCGGC
TGTTTCTCCATGTACCGCATCCGTGCTGCCGAGAGTGGCAAGCCCCTGTTCGTGTCTCGGGAAATTGTGGAGAGCTACTC
GACCATCCGTGTCGATACGCTGCACATGAAGAATCTGCTGCACCTCGGTGAAGATCGGTATCTGACGACGCTGCTGCTCA
AGTACCACGGCAAGTACAAGACGAAATACATCCAGAGCGCCCATGCCTGGACCATCGCGCCGGACTCCTGGCAGGTGTTC
CTGTCACAGCGTCGACGCTGGATCAACTCAACCGTGCACAACCTGATGGAACTGATGCCCATGTCACAACTCTGCGGCTT
CTGCTGTTTCTCGATGCGCTTTGTCGTCTTTATCGATCTTCTGTCGACGCTTATCCAGCCGGTCACCCTCGCGTACATCG
TCTACCTGATTGTTGAGGTCGTCACGAAGAGGACAGTGGTACCCATCACGGCCTTCATCTTGCTCGGTGCAATCTATGGT
CTGCAGGCTGCCATTTTCATCCTTCACCGCAAGTGGGAAATGATTGGCTGGATGGTTATGTACATTGTGGCCATTCCCGT
CTTCACATTCGCCCTACCGCTGTACTCCTTCTGGAACATGGACGACTTCAACTGGGGCAACACCCGTGTGGTGGCTGGTG
AGAAGGGCAACAAGATTGTCATTTCGGATGAGGGCAAGTTCGACCCGTCGACAATTCCGCGCAAAAAGTGGGAAGAGTAC
CAGGCCGAGCTCTGGGATGCGCAGACAGCCCACGACGACGCACACTCCGAGATCTCGGGATACTCGTATGCCACCAAGCA
GGGCGGCCTGGCGGTCCACACCATGCCCATGTCTGAGTACGGCTACGCATCGCGGCCTGGTTCGACCACCGGCTACGCGA
TGCACGACAAGACGGCAGGGGGTGCAAGCCGCATGAGCTTTGCGATGACCGAGCAACCAGGCAACCGTATGAGCCAGTTT
GGCGGGAGCCAGTTCTTCGCCGGCTCCGAAATGGAAATGGCCAATCTAGCAGGCCTGCCTAGCGACGACGCACTGCTGGC
CGAGATCCGTGAGATCCTGCGGACGGCTGACCTGATGACGATCACGAAGAAGGCAATCAAGCAGGAGCTTGAGCGGCGGT
TTGGCGTCGCCCTCGACGCACGGCGTGCCTACATCAACAGCGGTATGTCTGAGTTCCTATCTTCCCGAGCTGTGGCTGCC
AGGCTCTGAAGCAATGACTGACTTTCTCGATTTTAGCAACGGAGGCACTCCTCTCTGGCCAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62