GenePrediction:GLEAN_2543 Details

Name: GLEAN_2543
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1777312..1780764 (+ strand)
Length: 3453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1777312..1778249 (+ strand)
Length: 938
Type: CDS
Source: GLEAN
Position: GCSC_140:1778856..1780764 (+ strand)
Length: 1909
>GLEAN_2543 class=GenePrediction position=GCSC_140:1777312..1780764 (+ strand)
ATGCGCACCGGCTCGTTCTGGATCGCCGCCTTGGCGGCCGCTTCATCGGTCGGCGCCGTTGATGAAAATGGCCGGCCACG
GATATATTTCCCCAGACATGTCAAACGATCCTACGTCAATGCAACAAGCACACAGCCGAGCCCTCACCCGGCACCGCCAA
CGACTCTCGGTCCTCAGAGCACGACCCTTTTTCCGGCGTCGACCGATTCCGACAGCGTGCTCACCACGTCCTTCACAGAC
AGCTCAAGCAGGGCGGATAGCTCGAGCAGCGCAGACAGCTCGAATGATCCGGATAGTTTTAGCAGCTCGAGTTCTCCGGG
GACTACCAAGCGGCAGACAACGTCGGACATTTTCTCCCTGGGACAGAGCTCTATATCGCTCGAAGCCAGCACTGACAGCG
TGAGCTCGCACTCCTTAACCGGCTCTCGTATTCCGGGCTCCTTCGTACGGTCGACCGAGATCACGAAGTCTGGCAGCAGC
GGCATCATTGTTGTTGTGGAAACCAGCACCGTTGTCGTGCCACCTACCACGTCCACCACATCTACCAGCACCGGCCCAAG
GAGCTCGTCTACCGCAACGACGACGGCGTCTACCAGTGGTACCTCGTCCAGCGCAGACGGCACTTTGGCAGCGACCAAGG
CTACGACTGGTACAACTGATTCGGCGTCAGATGCGTCCACGGCGACGGGATCGACAAGGGCGACCACATCCAAGACTACC
TCTGCTTCGACTGATTCGGCGTCGGATGCGTCCACAGCGGCGGCGTCGACAAAGACGACCACGGCTAAGACTGCTACGAC
GGGCTCGACATCAGGTACGACTACAGCCAAGACTGGCCCGACTGTCTCGGCATCGGACGCGTCGACGGCGTCAACGGTTA
AGACTTCCGCAACGGATTCGGCATCAGATGCTTCATCGGCGGCGACGTCGGCGCAAACGTCGAAGAAGACGACTGCAGCC
AAGACATTGACCACAGCCTTGACGACGGGTGCGGCTACATCAGCGAATGTGTCTTCGGTAGAGCCAACATCAGGAGCTGC
ATCGTCGGCAGAGCCTACGTCGGCAGAAGCCACATCGGGAGCTGCATCATCGGCAGAGCCCACATCGGCAGAGTCCACAT
CAGCAGAACCCACATCAGCAGCTGCATCGTCGGTAGAGCCTACGTCGGCAGAAGCCACATCGGCGGAGACAACATCGAAG
AAATCGACGAAATCGACAAAATCGACAAAATCGACCGCCACCAAGACGAAGGGGACAGAATCAGGGGCCTCTACCGAGGT
GTCCTCGTCCCCAGAATCGGCAGCATCGTCTGCGGCACCGTCGTCTGCTCCGGAGGCTGTGTCTTCGACAGCACCATCCG
TGGCTACTACCAGTGGAAGAAAGACATATAGCGGCACTGTGTCGGCGACAGCGACTACTGACGCTGCATCGACAACTGCC
TTTACAATTGGATCTGCAATCCTTTCAGGAACGGCCCCAAGAACCTCCGTGGGCACTGCAGTGTCGTCGGCAGGGCTTGG
GTCAGCTTCCATTGCTCCCAGCAGCGTGCTTAGCTCCTCGGGTATTGTTGTCTACCCCGGCACTGCTGGCACGAAGACGA
CCTCCGCGGCGTCTTCCTCCGCAACCGACCCCCTGGCCGGGCTTACGTCTCTTCTGGGCATCAGCGCCACTGTCAACGGG
ACGATTGCTGACCCTCTGACGACGGCGGCGCCTTCAAGCGCTGCGGCAAGTGCGATTGTGTCTGGCTCTGGTTATTCGTC
CTACCTTCCGACGACGGCGGCAACCGAGTCTGCAAATGCCACTGGCGCAGCAAGCACTGTTGCTGCGACCACTGATGCAG
CCAGCAGCAGCATCCCGTTGTCCGGGTACTCTGGCGCCGGCACTGGCACTGGTGCTTCCGCTCTTCCACCGACGGCGATT
GTGTCGGCCGTTTCGTCTTCTGTGCTTGCTTCCGTGTTGCCGACCGGCTCTCTGTCGCAGTCGGCAACCGGAACCGGTAT
TCCGTTGAGCACGAACACTACGGCGAGCTCGGTCATCCCGGCGTCTACGGGCACTGCGGTTTCGGTCGGGACGTCGTCTA
GACTTACTGCATCGCAGACTGCGAACGGCACCGAATCCGTTGCGCCCACGACGTCTTCCGCCTCTCTGACTGCCTCCCCG
GCGCCCATCACGGTGCTGCCGACGGTGTCGACCAACAGCACATCGGTAGCAGGCAATACGACGATCCCTATCGTCGTGCC
TATCTCCACGTCTGCACCTGTGTCCGCATCTGCATTTGCATCCGGGTCAGCATCAGCATCAGCATCAGCATCAGGATTTG
TATCTGTATCGGCTTCCGCGTCTGGGTCTGGGACTGCGCCTGCGTTTGTGACTTCGTCTGCGCCTGTGACTCTGTCCACA
CCTCCGGCGGTTGGATCGACAACGGTGATGGCAAGCGTGGGGTCCAGCGTTACGCCGGCTGCCCAGCCTCCCTCCAGCTC
CCAGGCGGCAGCCGAGACGTGGCTGCCGACGACAATCATTGTGCAGCCGTCACCGACGTTCCAGAGCTCGATGAGCGCGA
CGACTACGGCAACGGGCATCCCGACTGGGCTTCCCAAAGCCATCACGCCAAACACAGACAGCGGCTCGAAGCCGGTGGAC
ACGACAGAGATCCAAATTGCGTTCACGTACGGCCTGAACTATGCGTTCGTGGCCGTGACGCCCAAGGCCGCAGCTCAGGT
TCTCTCGGTCCTGCCGGGGATCCTGTCGTACCAGGCCGGCTTCGACCAGAACATGACGGTTGTGCAGCGCCTGGTTCCGT
ACGACACGACGGAACAGCTGGGCTACGTGACGATGCTTGCCATCTGCACGTACCCGACGAGCCTGGTGAACCAGCTGCGC
CTGGACATGCACATTCCCACGGCGCCGATCTGGCAGAACCCTGACGGACTGGCGTACAACATGTCGCAGGAGATCAACAC
GGCCATCGACATCCTGATGGGCTCGACGCTGGACTACACACCGAGCGACACGACGGGCAGCTCGACGGCGTCGTCGACGT
CCAACTCGAACGACGCATTCGGCAATGCTAACGGCAACAGCCAGTCGTCATCGCAGCGGGGCACAACGGCCGGCATTGCT
GTGGGCGCGGTGTTTGTGTCGGCTGCGTACGGAACGGCCATGTTTGTGATTGCACGGCGGTACAAGCGCAAGAGGCAGTC
GCTGCACCAGCGCAGCAGCTCTGTGGGAACGCCCTCGGATATGCGACAGACGGGCAGCCCTGCCCTGATGGGCGGCGCGC
TTCTGAGCCGGGACTTCACGTCGACATATGGCGGCGTGGCAGGCGCAGCAGCAGGCACAGCAGCAGGCGGCCGTAACAGC
CACGGAAGTGGACGAAGCAACATGAACAACTCTGCACGCACGGCTTACATCTCGGCGCCGGTGGCGGCGGAGAACTCGCT
CGGCTGGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62