GenePrediction:GLEAN_2545 Details

Name: GLEAN_2545
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1786740..1788094 (+ strand)
Length: 1355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1786740..1786762 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:1786846..1787061 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_140:1787118..1787928 (+ strand)
Length: 811
Type: CDS
Source: GLEAN
Position: GCSC_140:1787990..1788094 (+ strand)
Length: 105
>GLEAN_2545 class=GenePrediction position=GCSC_140:1786740..1788094 (+ strand)
ATGTTCAGCTGGGCCAAGCAGACGTTAGTTCTTCCCTATCTCTCGTCGACAGCGTGCTGCCGTCCTATCCGTGTCCGTGC
CTGAATCAGCCTAACAAATGCTGCAGACTCGCCCATGTGGCCGGCACCCAGGAGCCTATTTATGGCTCGACAGCCGTCAA
GTCCGTGGCCGGGGAGACCAAGGAGACGCCTTACACGGAGACCACACGGGAGCACCTGAAGTGGACGGCGATGGAATCGA
CCTGTGTCGAGACCCAGGTATTCTACTTCACATCCGACAGCGGTCCCACTGCGTTTGTCCAGGTGATCTACAACAACATC
TCGTACGCCAGCCTCTCCTGTCTTGCACTCCCTAAACGGTCTAGCTAACAGACATCAGGGGCATCCGCACCACGTGCCAG
TTCAACACCAAGATCTTCTACCCTGGCGAGACCAACAAGAAGACGCTCTGGAGTTCTACCCCGCTCAGGGACCACGAGTT
TAGCGAAGACATGACATCCTTTTATGCCACGGACTGCGCCGTCGAGCTGTCCGAGGACGGCGAGTCGTACTCGATCAAGT
CGCTCAACGACGACCGTGCCATTGTCAATCTGACTGTCAAGCGCACCGCGCCCGGTTTCCAGGCCGGAAAGACCGGCCGC
TCTCTGTTTGGCACCGACCTTGACGACCCCTGGGGCTCCATGCGCCACGTCTTCTGGCCACGCTGCGTTGCCTCTGGTTC
CATCACGACCACGGAGGACGGCCCGCTCAGCTTTGACGGCTACCGCGGCCTCTTCATCCACGCCCTGCAGGGCATGAAGC
CACACCACCTGGCGTCCCGCTGGAACTTTGCCAATTTCCAGAGCAAGGAGTACTCGGCCGTGCTGATGGAGTTTACGACA
CCACCGTCGTACGGCTCTACCGTCATCACCGTCGGCGGCATTGCGCGCGACGGCGAGATCATCATCGCCGGCACCGATCA
GACGACCACGCACCTGGCCGTTAAGGAGGACTCGGAGAACGACTGGCCCGAGCCGACGCAGATCCGCTTTACCTGGTCTG
GCACGGCTAAGGACGGCAGCAAGGTTGATGCCGTGGTGGAGGGCGCCCTGGAGGAGAGACTGGACCGCATAGACGTCATG
GCCGAGGTCCCAGGGTTCGTCAAGAAGATTGCTGGCAGCGTGGCCGGCACGAAGCCATACATCTACCAGGTACGTTTGGC
GAGACCCACAGACCCAGAGGCCCAGATTCTCCGATTGCTGACAAAAACAGTACTACCCGCACAAGGCGCCGATTGCGCTG
AAGCTGAAGCAGGGCGACCAGACAGAGATCACGGAGCCAGGACGGCTGTTTTGCGAGGCGACGTTCATCTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62