GenePrediction:GLEAN_2546 Details

Name: GLEAN_2546
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1791408..1792062 (+ strand)
Length: 655
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1791408..1791655 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_140:1791846..1792062 (+ strand)
Length: 217
>GLEAN_2546 class=GenePrediction position=GCSC_140:1791408..1792062 (+ strand)
ATGGCGCCCGTTAGGCCAAATGGGGCGAGAAAGCCGAGCCTTGATCGACGGCAGGCGGAAGATAGGAGAGCGGACGACGG
ACGTTGCCAGACGGACACGCAATATGGTCCTCACTGGTGCGTCAGATACGTCGTACTCTTGTGGGATCCTAAACCGCCGA
AACATGCTCGTTTCGCCAGATTTGTCCCGCTGGTGGGCTGCCCCGTTTACGAGCAAGAGACGACGGAGTACAAGGACGGA
GTAGTGTCGTAAGATACGTGTGCCTGCACGGAGTATCCCCGCTCGTTTCTCCGTTTTCGTTCTTTGCTTTCGGTGCGGCA
GTAAGCAGACTCGCAGCTGTGCTTGTATATGAGTGCATACGACTACGAGCCAACAAAAACAATGCACAATACCAAGACAA
CCAGCAAGATAAGCGACAGCCGGCCTGCAGTCTTGCAGAGCCGGCAAGCGCGAAGCACAAGACTACTTCAGCCTGCCTCG
CCTTGCCCCGAATCTGCCTAGCGCCCCTTTGTCCCACCGCCTGCAAATGATTGGCCTGCTGCTCCCCAAGGCAGACTCTG
AAAGGACCGCTGCTCGCCTGCTGACTCATTGCTTAACCGACACTGGGCTCCGGAGGGCTGAGAGGCAGCCAATCCCGTGC
TTACATACGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62