GenePrediction:GLEAN_2547 Details

Name: GLEAN_2547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1792537..1796097 (+ strand)
Length: 3561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1792537..1792751 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_140:1792825..1794950 (+ strand)
Length: 2126
Type: CDS
Source: GLEAN
Position: GCSC_140:1795003..1795268 (+ strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_140:1795333..1796097 (+ strand)
Length: 765
>GLEAN_2547 class=GenePrediction position=GCSC_140:1792537..1796097 (+ strand)
ATGGAGCCAAAGAAATTTGCCTCCGTGTTGGAGGACGACGTTTTGTCCCTCTCGGGCCGCGATGGCGTCTCCCTCCCGCT
CTTTCGGCCACAGTCCCCCACTCCGTCTGGTCGCTTCACCCTCCGTCGAAGCATTCAGTCCAACCGCTCGTCCTTCTCTG
CAGCCTCCTCCCACTGCTCTGCTTCTCTAGACCCCGCCGCCCTCATGTCTTGTGTGTGAGTAGCGCGGTCACCGCCCGTA
CGATGTCTGCTGTGCCGAGTGAGCGAGCCTAACGCCTTTTTTCCTTAGAACCCGCGAGACGTCCAAGGACGACTGCGGAA
CCGATCGCTTCGTCGTCTGGGCCGCCGTCAAGCGGAACACCTCTGACCGCATGACCGACCGCGAGCGGCTCGAGTGTCCG
CTCCTCCGCTGCACCCTCCGCTTCCCGGATCATGAGTCCATGCTTCGCCATCTGGTCAGCTGTGAGCACCTCTCGTCCTG
CGAGTACTGGTGCTACGATCACATGCGCATCGAGCGCTTTGACGACAGCCGCTGCAGAAAGTGCCTCGGCCATGCTTCCA
AGCGGCGTAAGATGTTGTCCATGGCCAAACACTTCTTCACCGCCATCGGCCACACCAAGGGAAAAAGCATAGCTGGCGAT
CCTTTTCCCTCGTCGCCATCTTTTCTGTCGACATCCGTATCGGACTTTGGCTGCGACTGCATAAGTAGAAATGGCAGCAG
CCACCACAGCCACAGTCACCGTGATGACGACCGCAGCAGGCGCAACAGCAGCTGCCACCGCGCCGGTGGTCCGTCTGCTA
CTTCTGCAACCTCGACCTCTTCATCGTCATCGTCCGCCTCCTATCCGCCTTCATTTTCATTCTTTGGCCCTCCGCCGCCG
GACTGCGAGGCCATCAACGGAAACAACCATGCGGAGCTACCTACTACCAGCGAGCTTCCCGTGGAGATCGACTCCAGAGA
GCTTGCCCAGATCCCGCGGCAGTTTCTCTTCGAGCCCATCCCTGTTGGGCCAACGGCAGCTGGCTCTCCAGATCCTGTAT
CTGTCAGTCCTGTTGCTTCGTTGCCCGCAGTCGAGACCCAACCAAGCTCTATCAATCCCCAGGATCTGCTACTTCCAGAG
CTTGAGTCTATGAACTGGGAATCGAATGAGGTTGCGATGCCGTCTATATCTGCCGTTATTGACAACTCTGGCATCTCGGC
CTCTTTCCCGTCTTTTTTGGACGTACAGGAAAGCAACGAAATGCCGTATTCCGATGACGTTGCTGGCGGCTCACGGCCCC
TCCTCCAGCTCCATATACAACAAAGCCACGATGGCATATTGGGCCAACTGTCTTGTGGAGCACAGCCGCCGTCTCAGCGG
GCGGTGCGTCCGTCTGCAGCCCCGGCGCCGCGCAGTAAGAATTTGTCACCGAGCTCCTCGGTTCGGTCGACAACGAGCAC
AACAAGCACCACGAGCGCCTTGAGCGCCATGAGCGACATGAGCGCCGCAAGCTACTCGTCCGCCGCAACGACGGTGAGCC
TCATTAGTAATGTAGGCTCTCTTGTCTCACCCATCTCCGACTGCAGCTACGGCTCCAACCAGTGGCCGACTGACCTGGAG
ACCGGTCAAACGTCGCCAATGTCCAACTTCAACGACTTGTTTTCCGACGACCTGTTTGCTGGTGCCGAAGAGACAATTAG
CACAGACGTCTGTGAAGAGTTGAGCCTCTTGACGGATGACTCGTTTCTGCTCGACGTGGATATCGGGGCCGAGACGGAGT
TGCCTAAAAGCTCTGGCTCAGCTCCTCTACTGTTCGACTTTGAAGCCCCATTGCCATCAGCAAGGCCACAAGCAGGACCA
ACTGAGCCCTGTATCACGGCCACTTCTTCAACCAATGTTGAGGCCAATACGAGCACAGGAATTTCCGAGATCGAAGCATT
TGTGGCTACCGCATGGTATCTACTGCTGACGCACATCACAACATCGGCCACTAAGCTCCGAAGAATGGGCATGAGCAACA
GGCTAGCCACCCTCCTGCGGCAGACGTCACCCGTAGATATTGCCAAAACCGGCATGCAGACTTTGCGGACGGCCCTGATC
TCTGGAGACGAAAACACGACCCCCTTCGCCACCCTCTGCTTCCTTCATGCCATTTACGCTTTTTCGCTTATCACGTACGG
GCCAGAGGCAGCATCACGTTCAGACGAGCTCTTTACCCAAGCGCTTGTATATTCTCGAAACTTTACCGGCCCAGATCGCG
ACAGTTACCTGCAGATTATCACTGTGATCTGGCAGCCTAGCAACACGTCGTTAGCCGTGCTGGCCCAACACATCCAGTCG
CCCTTATTTGACCTGGGGAAAAACGCCTCTGCGCCTAGCAGTGGATTGGCTATTGACAACCCTGTTATTGCCACTGCCAA
GGCATACCTGGATGGTAAGTGATCGCTCGTCCTCCCACCTTTGCCTTGACTAATATTTTGGCATAGATTTGGAGGCTTCT
GTGATCATGGGTCCTACCTCTCCGTCGGAAGTTCATACCTCATCTCTGCTAGAGAAACACACGAAACACCTGGGTGCAGA
GAACTCGGCAGACTTCATTTCCTCTGCGAGCGCAGTTCTGAAAACGCTTATCCGGGAATTTCCCAGAGTTGACGGCAGGA
CGCGTGACTTCAATGAGATTGGCCGACGGGTGGCAACCGGTTCACTAAGAAGTGTCCGGAAGTTTGAATTGGGGCTGTAC
CAGGCAGGAAAGGTGAGCTCATGGAGACTGCTGAAATTCATACACGATCTGGGCTGACATCGCTGGTCTCAACCAGGCTT
CTCTTGGCTGCTCTGCCACATTCTTTGACCTGTTTGTCCCTCGGCTTAGACGCCTTTGTGACCATATCTACGCCATCCAT
ACGTCTGCGGGCAACCAGCGTCTGGCATATTACGAAGCAAGCACATTACTGGTACTGACAATTTTCGAAGAGATGGACAA
TGGCCTGGGGCGAAACGGCCTGCCAGCAGACGAACGCTTATACGGAACGTTGTCCCCGATTGCCATGGCCAAGGTCGGCG
ACAAAACGCAACTGCTGCTCCCTTTCACAGGTCTCTCGGAAAATAATATTTCCCTTCTCAGCACGACGCAGCCCTACACA
GCGGCTGTAGCCGGAAGTCCGACACCGTCAACGATGGAAGTGGAGTTTTCAGGAGCAGAAGAGGCACCGTCGGCAGAGAC
GCCTGCCGGCCAGAAAGTTGAAGTCGAATCCGACGCTTGCTGTCAGATATGCAGCTATCGACCCAAGGGTGATCCGCAGT
GGTTTCGCGGGTCCATGAACAAGCACATGAAGACGAAGCATTCGGGGGAGGTGATTTATAAATGTCCCTATCCCAACTGC
AACAGCCAGTATCGCAATCGGCTAGACAATCTGCAACAGCACCAGAGGGAGAAGAACCATTTTGTTGGTAGTGAGCAGGT
AGTAAAGAAGGCCCGACGCCAGAGTCAGACGGAACAGACAGACAGCATCAGCGAGCAGGGATCGAGTGATGGGACGGGCG
CGACGAGACGGCCAAGCAAGAGGAAGAAGTTGTCAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62