GenePrediction:GLEAN_2549 Details

Name: GLEAN_2549
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1800530..1804507 (+ strand)
Length: 3978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1800530..1800790 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:1800889..1801007 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_140:1801081..1801319 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:1801415..1801529 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_140:1801605..1801618 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:1801692..1801713 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:1801785..1802074 (+ strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_140:1802666..1803377 (+ strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_140:1803434..1803509 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_140:1803639..1803988 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_140:1804048..1804392 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_140:1804441..1804507 (+ strand)
Length: 67
>GLEAN_2549 class=GenePrediction position=GCSC_140:1800530..1804507 (+ strand)
ATGCCTCCGTCGGCCGAGCCGTTGGTATCGTCTGATTCGGACAGTGCTGCCCATCACCTCCTGTCCATGTCGCTTGCCAG
CAAGGCTGCCGCCCTTCATGTCGAGGCCAACCGTCATGTCGATATCATTGACATCCGACGCGGCGAGCTAGAGATCAATC
TCAAGCAGGAGATTTTCTCCTCATTCAGTCCCGAGGACGGTCCCCGAGCACTGCCCACGCTGCTTCTCTACGACGAGAAG
GGCTTACAGCTGTTTGAACAGGTGAGGCTCACTTGCAAGCACCATTTGCTGCACAGCCCATCCCGTCCTTGTTCTATGAC
CAATCCGCTTGTCCTGCTGACCACCTTCTGCAACCGCAGATCACATTCCTGGAGCAATACTACCTCACCAACTATGAGGC
TGCCATTCTTGAGGCTTCGGCCGCGAGCATAGCCGCAAAGATTCCACAGGGCGCCATGGTCCTCGAGCTAGGCAGCGGGT
GCGTTGTTGCTCGTGATGCCATCCCAGCACCCCTTCGCAAACGGGATCCTTGCACTGACAGCATCAAACAGAAATCTCCG
GAAAGTGAGCTTGCTTTTGCGGGCTTTTGAAGCGGTCGGCAAAAAGGTGGAATACTATGCCCTGGACCTCTCGCGTCGTG
AGCTGGAGCGTACGCTCGCCCAGCTGCCGAAGTTCGAACACGTCACCTGTCATGGCCTGCTCGGCACGTATGATGATGGG
CGTGAGTGGCTGAAGTCGCCCTCTGTCCTTTACCGCCAGAAGTGCATCCTCTCGCTCGGATCCAGCATCGGTAAGGCGCA
CCTATACGAGCTGACTATGAGGGCGGCCGTCTGGAACGGGATCAGTCACTCTTGTATTTTTTCAGTGTGTTGACTCTACG
GACAGGAAACTTCCAGCCGAATGAGGCCGCCGAGTTCCTCCGCAGCTTTGCAGATGTGCTACAGATGGGAGATGCCATGC
TCATCGGACTCGACAGCTGTACCGACCCGCGCAAAATCTAGTGAGTCTTGCCTGCTCGTATTGGCCTTTGCCGTGGTTTT
TATCTGGGCGCTGGGCTGACTTATCATGTTATTAGCCACGCATACAATGGTCAGTGAATCGTATCTAACACGAGACCGCT
TGTGCTTGCTGTATTTGGTAGGGCTAACAATATGATTCGCAGACAACCAAGGAACCACCCACAGGTATGGGATATGCTCT
GACCACTCACAGCAGGAACTGCTATATATGATGTATGGCTGACACGACGAACCAGATTCATCCTGAACGGCCTTGCCCAC
GCTAACGAAATACTGGGCGAGGAGGCTTTTCAGCCGTCGGAATGGCATGTCATCGGCGAGTATGTGCATGACGCCCGGGG
CGGTTACCACCAGGCATTCGTCTCGCCGATCCACACGACTGTGGTTCTGGGAGAAACTGTCAGGGCCTATGAGCGAATCA
AGTTCGAGGAGAGCTGGAAGTATGCCGATGACGAGGTGAAAGCGCTGTGGCAGGCGGCCGGCTTGGTCGAGTCCTGCCGA
TGGGAACATAGCAACAAGGAATATGGTAAGATGATCACGCAACTTTTCTCCAGCACCCTCTTCCCCGGAACCTATTACCG
GAATCGGCGCCGGCGCCGGCAAACAAAGAGCACTGAACAGTTTCAGACCACCTATTTGCCGTTTCGACTTCCTCCCACGT
TTTTACACAACCACCTACACCGTCACTTTCCCCACCACACCATCTTGTTACACTTCACCCCACGCTTTCTCACGTTGGGG
GTGCCCCTCGTCGCCGGGTCCTGTGACTTGGCTTCCAGTGGAGTCGCACCCCAGACAAATGCCAGCTTCGACATGCTTCT
AGTTCTTGCGTTTTGCATGTACCCAAAGCCGCCTAGCTGCATCTGTTTCCCCCGTTCACGCTTGTCCCTGTCGGTCCCTG
CGCGCCCGAAATGCATTCTCTTCTCTTAATGCCGCTGCATCGCTGCAAGACTGGCGCGATGACATATGAGGCGGGAAAAG
CTGCTTGCCCGGGCCGTTGGTATACTTATGGGTCAATCATGCCAGTCGAGCAGGCACGGCTTTGGTCCGGGTCCTCTTGT
TTTAATTGGCGTTATTGCCCTCCCCTGGACATGTTCGCCCTAGCTAACTTCCAAAGGAATTCACATGCTCTCCAAACAGA
AGATGTCTTTCAGCCTGCTCCCGTCCATTTACGCCAAGACGGCGCTTCCGTCGCTGGAAGACTGGGAGGCTACCTGGGCG
GCCTGGGATACGGTGACCCGGCGCATGCTTCCCGATGAGGGGCTGCTTGACAAGCCAATCAAGCTGAGAAATGCTTGCAT
TTTCTACCTCGGCCACAGTCCAACCTTCCTTGACATCCAGCTGAACAAAACGATCGGAGGGACCCCGACAGAACCCGCAA
GCTATGCGTCCATCTTCGAGCGAGGCATTGACCCGGATGTCGACAATCCGGAGCTGTGCCACTCCCATTCCGAGATCCCA
GACGAGTGGCCTCCGCTGAACGATATCCTTGCCTACCAGAGCCGAGTTCGGGAGAGACTCCGGGGTATATATGGGCCCGG
CAATGGAAGCAACCCCAGCCACGCACACATCCCACGTCCTGTAGCCCAAGCTATCTGGGCTGGGTTCGAGCACGATCTCA
TGCATCTTGAGACTCTGCTCTACATGATGCTGCAGAGCGACAAAACGCTTCCTCCGCCGAACGTGCCGAGGCCGGACTTT
GCAGAGCTGGCTGAAAAGGCGCATGCAGCCCGGGTCCCGAACCAGTGGTTCAATGTGCCAGCGCAGGACATCTCCATTGG
CCTGGACGATCCCGAAAATGGAACGGAACTGACGCGCCATTTTGGCTGGTGGGTGTCTCCTGATAATTACGTACAATCAT
GCTATGGACTAACAGGGCCTCCAGGGACAACGAGAAGCCTGTCCGTCGAATCCATGTCGGTGCCTTCCAAGCCAAGGGAA
GGTCGATCACGAACGAAGAGGTGTGTACCGGCAGCCATTTCGTCAGCAGACGAGTTGTTCTGACAGGGTTTTAGTATGCG
CAATATGTTTTTAGCAACCATATTACGAGTCTTCCTACGTCTTGGACAGAGACTACAGGGTCCCAAAAGACAAATGGGCA
CACGAATGGACACGCCAACGGTCATGCGAACGGACACACAAACGGACACCAAATTGGACAAGTGAACGGCGCAGGTCAGT
CGGCTGCTACGCTGCCACTGCCGGCCTCATTCTTGCAAGGAATGGCTGTCCGGACGGTGTTTGGCCCGGTGCCTCTCGAG
CTTGCCCTGGACTGGCCTGTGTTTGCGTCGTATGACGAGCTGTCAGCCTGTGCGGCGTGGATGGGTGGCCGCATTCCGAC
GTTTGAGGAGGCACGCAGCATCTACGAACACGTGGATAGATTGCGCAAGAAGAAGGAGAAGAATCAGAACAGCAGTCGTG
CCGTTCCGGCGGTGAATGGGTGAGTTGATCACTTTTGCTGGTCCTATTAGGTCTTTCATCCATGCTGACTAATCAAAGAC
ACCTCTCTCTCAATGGTGTGAAGGAGACACCGCCGCAGGCAGCAAACGGCAACGGTGGTGCCGGCGCCTCGTCCGACTCG
CTCTTCATCGACCTGGAAGGCGCCAACGTTGGCCTGAAGCACTGGCACCCGATGCCGGTGACAGCCAACGGGGGGAGGCT
TGGGGGACAGAGCGAGATGGGTGGAGTGTGGGAGTGGACCAGCTCGCCGCTGCACCGCCATGCTGGATTCGAGCCGATGA
AGCTGTATCCGGCATACACGGCAGACTTCTTTGACGGAAAGCATAACATTGTGCTGGGCGGATCGTGGGCAACGCACCCT
CGCCTTGCTGGACGGAAGTCATTGTAAGTTGATCGTTTCCCGCGAAGAAAAGATGGAGGCTAACAGGCCAGTGTCAACTG
GTTCCAGCGAAACTACCTCTACGCCTGGGTAGGTGCTCGGCTGGTTCGGGATGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62