GenePrediction:GLEAN_254 Details

Name: GLEAN_254
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:557575..559562 (+ strand)
Length: 1988
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:557575..558016 (+ strand)
Length: 442
Type: CDS
Source: GLEAN
Position: GCSC_167:558091..559562 (+ strand)
Length: 1472
>GLEAN_254 class=GenePrediction position=GCSC_167:557575..559562 (+ strand)
ATGCCTCCGCGGACGAGGAGGGTTCTTCGCGGCGGAGCCACACCGGCAGCTAACAGCGATGATACGTCCGGCCAAGGCAG
CCCTGCCGCTGCATTGGAGCCGACAGCAGCTTCTGAAGCAGCAGGCGCAACAGAAGCTTCAGAAGCATCAACACTGGTAC
CAACACGAACAGCCGGGAGCCGGTCATTTAAGCTGCGGCCGAAGGTGGTGCGGCGTGCAGACGAGGAGCGCAAGGCTCTC
GCGGAGCAGGAAGAGAAGAAGCTGCTCGACCGTGCAGCAGTGGACGATGCTCGCCGACGGAGAGAGAGCCGGATGCGAGG
TGGCCGGGGTCGAGGTCGGGGAGGTCGTGGTCGTGGCCGGGGAGATTTTGCTGGTGGCCGTGATGGTCTAATCAGACGGA
CAGTGGCGCCTGACGGGCCGTTCTCGCAGATGCCGGGTTCATGTAAGGCAGCCTCGGTGTGCTTGTGCTTCCCTTTTGGT
TGTCGAACATTTCTCTGACAGCTCTCTCTTCTGCAGTATCTCAAGGCCGTGGCAGACCAGGACAGGGTGGCTTCGGCGGT
GGTGGCGGTGGCGGTGGTGGTGGTGGTTTTGGCGGCGGTGGCAGAGGGTCGGGTCCCAGCTCTGGCGGGTTTCTTTCGGT
TTCTGGCCCGGCGGTAGAGGTCGACCTGCGGCTGAACACGGACATGTTTAACGGACGGATGGCGGACTACGCAGACGGCG
ACGACGTGGCGGTCAAGGACGAGTTCGCAGCCGAAACGATCAGCAGCACCAGCTCGGGCAAGAAGATACCACAGCTGTTG
CCGATGGGCATCAAGCGGGAGGAGTTCCGGGAGACGGGGATGGTGGTGGCAGCGACCGATGAGCTCGAGGCGACAGCGGG
TGAAGGGGACGCGGTGGACGACGGAGAGGCCGACGACTCGGGCTCCGATCTGTTTATCGGGAACGGCGACGTGACGACAA
CGGGTGGCAGCGCCGACGACGACGAGGTGTGGTCCCGGGCGATTAAGACGCAGCGAGGCGTAAAGCTGATCGGACCGGAC
GGCCAGGAGATTGAGGTGACGGACATTGACACGCTGGCAGAGAAGCGGCAGGAGATTGCGGCAGCCGCAGCAGCAGCCGG
ACAAAGACCAAGCGGCGAGGAGGGAGAAGAGGGCGGCATCAGCAGCAGCAGTGGTGTGGTCAAGACGAAGAAGCGGAGAC
CGCAGAAGGAAAAGGAAAAGGACCCGGAAGAGGTGATGGTGGAAGAGGGCCTGCAGGCGATGCTGCACGACCTGGCCATT
GACCCGCCGCGCGATTCGGGAACAGCACCGCTGGCCATCCACTCCAACGAGTCTGCGGCCGACGACGAAGAAGAGAGACG
GAAGCAGCAGGAGTCCGCCGAGGCGCCGCAGCGGGAGGGCCGGCTGTTCCTGTTTCAGTTTCCGCCGGTGCTGCCGTCGC
TGCAGCCCTTCCAGCCGAGCAGTCCGACAATCAAGAACAGCAGCCACGTGGGCGGTGTCGTGAAGCCGGATCCGGACGAG
CACAGCGACGTGGTGATGCTCGACAGCGTGCCAGCGGCAGCGGCGGTAGATCTCACGGGCAGCGGTGACAACAGCAACGA
CAACGACGGACGCAAGCCATCGGACATTGGCGAGGGCGGCTTCCTCGGCACGCTGACGATCCGCAAGTCCGGGCGGGCCG
AGCTCAGCTGGGGCGGCATGACGTACGAGATGATGCCGGGCTCGGACGTGCAGTTCCTCACGACGGCAGTACTGCTGGAA
GAGGCAGACGAGAAGCCGAACGTGGGCGATGGACAGCCGACCGAGAACGCCGGTGGAAACGCGTTTGGCATGGGGCCGGT
GGGCGGCAAATACAACCTGGTGCCGGTGTTTAGCAGCGAGACCGAGTGGACGGTGGACCCGGCCGAGTTGGAGATGTACG
AGGACGAAGACGAGGACGAGGAGGACGAGGAGGACGAGGAGGAAGAGGCCACCGTCCAGGTCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62