GenePrediction:GLEAN_2551 Details

Name: GLEAN_2551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1811510..1814372 (+ strand)
Length: 2863
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1811510..1811543 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_140:1811780..1812087 (+ strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_140:1812186..1813584 (+ strand)
Length: 1399
Type: CDS
Source: GLEAN
Position: GCSC_140:1813651..1814372 (+ strand)
Length: 722
>GLEAN_2551 class=GenePrediction position=GCSC_140:1811510..1814372 (+ strand)
ATGGAAGTCGGCACGGATGATAAACAGCCCGAAGGTAAATCCACAGCCTATCATCGCTGACGTGAGCGCGCGCAAACAGC
GGCTCCTACAGCGGCTCCTACATACCCCACCCCCCCCCCCCTCCTTCCCTCCCCCTGTCTTCCCTCCAAATCAACGTTCT
TGATAAACAAGACGGGTGCCAAAAGAGAAATCCCAGAACAGCAGAGACTTGCGACAAACACTGGTGCCGTCCGTACTACA
GACAACTAACAGTCACCGCGCGTATGGCAGCTGTGAATCCACTAGAAATCCATCCCGAATCCCCCTCCGATGCTCCCGGT
GCAGAGGAAGAGCCAAAGTCTAGCCCCTCCGTTCGATTTCAGTCCAAGGTACAAGAGATTGGCCCTGTGGAGCTGTTGCC
CGAAACAGATCAGACTAGGGAGGATGAGCAGGGTTCCTATGGCCACAATGCAAGTGGCTCAGAAGGCGTGACCCAGGAAC
AGATACGTGCTCTTACCAACTCGATGCGCACTGCCCACCTGCAAGGCCTCCGAATAGCCAACTTCTCTTACGAGCCGTTC
TCCCTCCCGGCGTCAAGGGTAAGCAAGATACACAGCTGGCCTTTAGCCTAAGATCTGCCCAGAAGCTGTCTCGGCCTTCA
TCGGATGTGGGATGGGTCCCTGCTAACCACTTTCAGACTACATCCCACGATGACGGGTCATCACACCACACCACCCGCCA
ACACACTCCGATCTCGACCACAGGTCCCCATTCACCAATGCTCGGCGCCAAGGGCCACGACATGCAGTCGCCTCCACTAA
CGCCCCTGGGCAGCGCCCATGTCGACGGAGAAGCCAGGTCTCCCAGGTTGTCAGGTCTACATCACGGCTCCGCATCTCCG
CAGGCGGCGACACGGGAAGCCTCGCCCGCCAGAATGGCCCTGGCCGCACAACGGCCACAACGGCCGGCGTCTTCCGACGA
CATCGCGCGCCGCCCAGCATCCTCGTCAGGAGCGCATGACCACCCGCTAGCCGGCAATCACCGGAATGGCTTGTTCAGCA
TCGGCCCAACCACCAGCGGCTCTGGTGGCCCTTCCGGTGGATCACTGCCAGTGTCACGGGAATCAAGCGCTTCCGAACGG
TCTGCCTCGCAGTACTATTCGCGTCCCTTCACGCCTTCTGGTGACGCCAATGATCCGTACGCTGCCAACAAGCGCCATCC
TCAGAACAAGATCGAGCCTCGCTTTGTTTTCTCGCGACTGTCGAGAAGGAAGGATCACTCGCCGACCGCTTCTTCCATCT
CTCTTTCCAAGTACAAGGATGAGAAACGTCACTCAGGCTTCTTTAACAATCACCACCACCACAGGTCGGACACCGGCGAT
ACCGTCCAGGCCGATGAAGGCTCCGCTTCATCGCTGCACAGTCGCCAGGGTTCCATGTCCGATCTCAAGCGTTTCTTCAA
ACTCGGCCCGTCTCACCATCACAAGATCAAGCGAGCTGTGTCACCAGCTCTGTCCATCCGCTCTGCTCGCTCCTCAAGGG
CCACGGACAATGCTGGTTCAAGATCAAACGTGCAAATGCCTTTTGCCGACGACTCGCTGTCGTCCAAATACGGAAAGCTT
GGTAAAGTCCTCGGCGCCGGCGCCGGCGGATCCGTCCGCCTCATGAAGCGAAGCGAAGACAGCACCGTTTTTGCCGTGAA
GGAGTTTCGCGCGCGCCATACCTATGAATCCGAGAAAGAGTATGTCAAGAAGCTGACTGCCGAATACTGCATCGGCTCGT
CTCTCCACCATGGCAACATCATTGAGACTCTCGACATCATCAGTGAAAAGGGGAAATGGTATGAAGTTATGGAGTATGCG
CCCTACGATTTGTTCGCCATTGTCATGTCTGGCCGCATGTCCCGTCCTGAGATTGCCTGCTGTTTCTTACAGATCCTGAG
CGGTGTGACCTACCTGCACAGCATGGGATTGGCCCATCGGGATCTGAAGCTAGACAACGTCGTCGTCAGCGAACACGGCA
TTATGAAAATTATTGATTTTGGCAGCGCTCATGTGTACCAATATCCGTTTGAAAATGGCGTTGTCATGGCGTCAGGTTAG
TAGCATTTGTCTTACCGTCTTTCCCCGCTCTACAAGAAGTACATATCTGACCACCGGGCAGGTATTGTGGGTTCCGATCC
TTACCTGGCGCCTGAAGTCTATGACGACCGGAAGTATGACCCAACAGCAGTTGACATCTGGTCGCTTGCTATCATATACT
GCTGCATGACACTCCGCCGATTTCCGTGGAAGGTTCCGCGCACGACTGACAATTCCTACAAGCTGTTTGCTGCGGATCCG
ACTCCAGGCCATGATCCCATGCGGTTGGGCGATCAGCGAAACAGAAGTTCAAATGACACTCCTCGATCAGAAGATGAAAA
GAAAGTCAAGGAAGCGAAAGCAGACGGTGTGGAAAAGGACGTCAAGGAAGCCAGAGTCGGCAAAGATGACAAGGCCACGA
AAGACGACAAAAATGGAAAAAATGGCCAGGCCGCTCGCCCAAGTTCCGACAGCAAGGATGGCAAGGACGAAAAGAGCGAA
AAAGACGATAAGAAAGAGACTGGCATTGACAAAGCTGGCGACAAATCCGGCGACAAGCCCGCCGAGAAGAAGGAAGTCAT
CAAAGGCCCGTGGCGGATTTTACGCCTTCTTCCCCGTGAAAGTCGGCACGTCATCGGTGGCATGCTGAAAATCGACCCCA
AGGACAGGATAAAGATGGGCGAAATTCTCAAGGACCCGTGGGTCTGTAACACGGTTATCTGCCTCCAGACTCAGCCAGGA
AAAGTGATTCGAGCAAACACACACACACACGTCCTCGAAGCACCCGCGCCAGCTATGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62