GenePrediction:GLEAN_2552 Details

Name: GLEAN_2552
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1814969..1815459 (+ strand)
Length: 491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1814969..1814971 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:1815085..1815371 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_140:1815435..1815459 (+ strand)
Length: 25
>GLEAN_2552 class=GenePrediction position=GCSC_140:1814969..1815459 (+ strand)
ATGGTGAGTGCATTTGATTTGTCATGTGTCGCTGGGGACGATATGTGCCTGGCGCACGCCCCAGATGAGCAGATAGACAG
GAGCATATCTGACACAACTTTTTCCCGCACTACCAGGCCAGCTCTATCCGCTCTATCAAGTCGCTTGTTCCCCTTCTCGA
CCGGGTTCTGGTCCAGCGCGTGAAGGCCGAGGCCAAGACCGCTAGCGGCATCTTCCTGCCCGAGTCCAGCGTCAAGGACC
TGAACGAGGCTCGCGTGCTGGCAGTCGGCCCGGGTGCGCTCGATAAGGAAGGCAAGCGGACACCAATGGGTGTCTCGGCC
GGCGACAAGGTGTTGATCCCCCAGTTCGGCGGCAGCCCGGTCAAAGTCGGCGAGGACGAGTACCACCTCTTCCGCGACAG
CGAGTAAGTATTTGCCGGCAACATCTGACAAGGAGACCTATATTGGTGACTGACTGAATCCTCTAGCATCCTGGCTAAGA
TCAACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62