GenePrediction:GLEAN_2553 Details

Name: GLEAN_2553
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1816711..1818321 (+ strand)
Length: 1611
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1816711..1816903 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_140:1816975..1817964 (+ strand)
Length: 990
Type: CDS
Source: GLEAN
Position: GCSC_140:1818167..1818321 (+ strand)
Length: 155
>GLEAN_2553 class=GenePrediction position=GCSC_140:1816711..1818321 (+ strand)
ATGATGCTGGCACATAACTTTATGGCTACACTTGTGTTTACCTTTGCGGCTGCCACCAGTGCCCACACTACTTTCACGGC
CCTCTTCGTAAATGGCGTCAACCAAGGTGATGGCACTTGCGTCCGCCAGCCAAAGGATCCTCAGACGTCGACTTTCCCAC
TACGGGATCTGACCAGCACTGATATGATTTGTGGTAGGTTCTCCAACCAGCTGTTGACTAATGATTTCGCGAGAAGTATG
ACCAGTCTGACAGTCTTTTTTCAGGCAGAGACGGGCTTGCTTCTGTCAGCTTCACCTGTACCGTTCCGGCCGGCGCCACG
CTGACCTTTGAGTTTCGCGAGAACCCCGACGGATCCAAACCGGGTACCATCGACCCATCCCACAAAGGGCCTTGTGCCGT
ATATATGAAACAGATGGCCAGCATGGGCACGATTCTATCCACGCCTACCGACGGTTGGTTCAAGATCTGGGAGCAGGGCT
ACAGCGCCGACACGAGTCAGTGGTGCACCGAGAAGCTCATCAAATCCAACGGCCTGCTCTCTGTTGCACTGCCACCTGAT
ATCCCAGATGGCAGCTACCTTGTGCGGCCACAGCTTCTGGCGCTGCATGAGGCACAGGTCAGCGACCCGCAGTTCTACGT
TGGCTGTGCGCAGATTTTTGTCACCGGCAGCAGCGGCAGCGGGGATCTATACGGAACAATTCCCGAAGGATACGAGGCCA
CAATCCCCGGCTATGTCAAAGCAGGAGATCCTTCCGTGACGTTTGATATATACGAGCTCATGTTCCCTTACCAGGTTCCG
GGGCCGTCGGTGTATTTTCCCACGGAACGCTCTGACAGGGGCAACTCTGCTGCTTCTGCTGCCTTGGTAAAGGCGGTTCT
CAGTTCAGGCGACCTCGCCGTGTCCCGCAAAGCCAATGTCGCGTTTGTGCCCCAAAGCTGCCTCATCAAGAACGCTAACT
GGTGCGGCGTCGAGGTTTCCACCTACTCCACGGAAAGCGGCTGCTGGGACGCCTCAGCCGACTGCTTCCACCAGGAGGGG
GTCTGCTATGAATCAGCACCACCTTCAGGCCACGCCAATTGTGACGTGTGGGACAAAAAGTGCTTGGAGATACAGGCTGC
TTGTGCGGCTGGGAACTTTGATGGACCACCCAACACGGGTCGTAGGCTGCAGCAGGTAGAGGCGGTCGTTCCTGGAGCCA
TCCCGTCGCCCGATACTGGTTTCGCGACTCCACCGGCTAGTGCTGGTATTGGAAGTAGACGGCAGTCGAAGAGATCGTCT
CGAATTTAGCCTGGAGAGGTTGAATAAGTCGAAACTGCTTGTACAAGTGGTATCGTAAGATCACGTGACTTGAAAGCATT
GCAGAGACCTATACGCCCACCGTGAAATTAATAAAATCACGCAATTTCTAAGGACCAATCACAGTTGACGTTCTCCTCTA
AGTTTGCCCTTTAAAGGTCAGGGTGCCGCCGCCCAACTCTGCCTTTACACCTCATCTCTTCATTTCGGCGGCTTGCTTGC
TGCTGAGGACGAGTATCGGCTGTTTCCAGGCTTGGTTTTGAGCCGCCGGTGCCGAGGAAGCACAGCAGGACAACGAGCAC
ATACGCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62