GenePrediction:GLEAN_2554 Details

Name: GLEAN_2554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1820743..1824978 (+ strand)
Length: 4236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1820743..1820965 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_140:1821023..1821149 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:1821209..1821836 (+ strand)
Length: 628
Type: CDS
Source: GLEAN
Position: GCSC_140:1821910..1822000 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_140:1822426..1822479 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:1822532..1824978 (+ strand)
Length: 2447
>GLEAN_2554 class=GenePrediction position=GCSC_140:1820743..1824978 (+ strand)
ATGGGCACTGGGATTGTGTCCATCTTACTGCACAATTTGCCTTACAGCACAGAGTGGATGCGATACATTTCCATTGCCAT
CTTCGCCCTCAACATTAGCTTGTTTTCCGTCTTCATGACCATCACAATGGCACGGTATATACTGTACCCAGAGATCTGGG
CCGTCATGATCAAACATCCGGCCCAGTCGCTCTTTCTGGGATGCATACCGATGGGCTTTGCTAGTACGCATTACCTCCCA
CCGAACACGCCTGGGATTTGCGCGTGCTGACTTATCTCAGCTATTATCAACATGCTTGTCTTTGTCTGTGCTCGCTGGGG
CAACTGGGCCATATATCTGGCCTGGGGCCTCTGGTGGGTGGACGTGGCCATGTCCTGCGTCACCAGCCTGACGATTCCGT
TCATCATGTAAGATCCCGGCCGCTCAGCCCGTGGTGCTCTCGCTGGCTCACAAAAACGAAACACAGGGTCCGTCTCCACA
AGAACCAGCTGTCCAACATGACCGCTGCCCTACTGCTTCCCGTCGTGCCCGTCATTGTCGCCGCAGCGTCGGGCGGCATC
GTGGCCGAGGTTCTTCCCAACGACAACCATGCTGTGATCACCCTCGTGGTTTCGTACATCATCTGGGGGCTGGGCCAGGC
CTTCTCTTTTCTCATCATGTCTATCTATTTCCTGCGCTTGCAAGTTCACGACCTGCCACCCCGCGAGGCCATTGTGTCTG
TGTTTTTGCCCATCGGGCCGCTCGGTCAGGGCGGCTTCGCCATTCAGCAGCTCGGCAAGGTGGCCATTGGCCTGCTCCCC
GTCACCGGTGCCTTCAACGGTGTCAGTATACCGACCGGCAGCAGCAGTGCCATGGCAGCCAGCGCCATGAACGGTGGCGT
TGTCCTGTACATGGTAGGCATTCTGTGCGCCTTTGTCATGTGGGGAGCCGCCTTGGGCTGGCTTGCCTTTGCCATCTTCG
CCATCTCGACTACCAGGTCGTTTCCCTTCAACATGGGCTGGTGGGGTTTCACCTTTCCGTTAGGAGTGTTCACCACATGT
ACTGGTCTGATGGCCACCGAACTTTCGAGTATATTTCTCAAAGTCCTGACCGAGGTAAGACAAACAACAACACAGACATA
CAATGGATCCCTGCGCAGCCTGCTGACTCCGAGTCGTTCTTTGTTAGATCTTCTCTATCTTGATTTTGTGTCTCTGGGCT
GTCATCGCTGCTAAGACTGTCCTCTTGGCTCTAACCGGCGACATGTTTTATGCCCCCTGTTTGAAAGACTTGAGTTCCGG
GACGGTGACAAATGCGGAGGAGAAGACAGCATAGACTGCCGACGCAGAGGGGTATAAAAGAAAAGAGGACGTTTAGAAAT
TCAGCATTGATGAGAGCTATGATTTGTTTTGTATATCCAATATAGATAAGGCAGCTTAAAGCCCATACTAAAGTTCTGCT
CAGGTTACTGCAGATGGCCTATTATAGGGTCTCAATCGCCCATTCAGCCGACGCTGGCCCTAATAATTCATTCTCACAAT
ATGGGTCGCGCCTGCCTTGCGCTGTGGGTTGGGGCTAAACTGCCACGGCTAACGAATGAGGGGCTCGTCAAATCGCATTG
CGAAATCCCCACTCATTAGAAAAAACCATTACAGCTTCACGTCGAAGGCAGTCGACGACACTGAAGCTGGGATCGACAAG
CAGCTATGGCCTCGACCGTGCGGGCCTCCAGCCCAGTTCTGCGCGATTTCGCAGACGGTAAGGTACTTGGCAACGCCCAC
GGAAAACACACTTGACTGACTGTGTCCAGGAGCCACTGACATATGGCATCACTACCGTATTCCAATCATCCTTTCCACAT
TTGCCATCTTGGTTTCCCTGCGCATATATTTCTTCTTTACGGACAAAGGTGATGATCATAAGGAAGGTCTACTTGTCTTC
CCCAAGATCTACAACGCAGATGATGCGACAGACAAATCAAAAGTAGACGACAGAGCCGAGAAAGCGCCAGCAACAGTGAT
TGCCGAAGTAAGCAGCCTAGGAGACGAAAAGAGAGGCAATGCTGCTCTGGTATCCACAGAAAAGCCTGCAAGTAGGTCGG
CGACAACGGCAGCTGGGCCGCGAAGAATCAAGGGCGAGTTGCCTGTTGGGCGTGGCCGGGCAGAGAACGGCGTAGCAACC
GCTCGCTCGTCTATAATACAATCCGTTATCTTCTTTTCTTCCCTGACCGGGGCTACGGCCAAAATTGTCCAAGACTATGC
TACAAAGCTGGGCGAATCTCTAGAGTCTCACGAGAAAAGCAAGGGCACTACCTTTGCGGCTCCCCAAGTCTTGGATCTGG
CTGAGGTGGACTACGACGAGTACTTTATCACACCGCCGACTCTCACGAAAACAGCCGATGGCGAGGGCGATGGCTCAGCA
GCCGACTTCTTCTACCTCTTCCTCATTCCAAGCTACAACATCGATTCGATCAACGATACGTTCCTCGAACATCTCAAGGA
GACACACCACGACTTCCGCATTGATACAGCACCTCTGACGCCTCTGATCGGCTACTCTGTCTTCGGCTTTGGCGACAAGG
AGGGCTGGCCCACGGAGGAGGAAGGCTTTTGCACCCAGGCCAAGGAGATTGACAAGTGGATGGCCAAGCTGTCGGGTCGC
AAGCGAGCCTTCCCGCTGGGCTTTGGTGACAGCAAGTCCGATGCGATGGTGCGGCTGGCCGAGTGGTCAGACGGTGTTGT
GGAAGTGCTTGATATATTTTCGCAAACCGGTAGTCTGGGCGAAGGCGTACCTGGCTCGGGCGATCCTACCGAAAGCGACG
ATGAAGAGGCTGACGACGAGGATGCGGAGTATGAAGACGATGAGGTGCTCTTCAGCGAGGACGCGGCTCGAAGTGCAAAC
GTAAACCGCCTCAAGAAGACGGGTATCATCGACGACGTCGAGGATCTGGGCCGGATCCTGCAAGAGTCCCAGGAAGACAG
CAAGGCGAGCACAACGCCGGCACCGATTGCTGTTGACTTCACCTCTTACGATGGCACCGGAAAGGGCCCACGTCGTGCAG
GACGTGGGACCAAAGCGGCGCCGGCACCGACGATTGTGCGGGAGATGGTGGCCAAGGACTCTCCCACGTACAAGTCCTTG
ACGAAGCAGGGGTACGCAGTGGTGGGGTCGCACTCTGGGGTCAAGATTTGTCGGTGGACCAAGTCGGCGCTGCGTGGCCG
TGGATCGTGCTACAAGTATTCGTTCTACGGCATCCACTCGCACCAGTGCATGGAGACGACGCCATCGTTGTCGTGTTCCA
ACAAGTGCGTTTTCTGTTGGCGTCACGGCACCAACCCGGTGGGCACGTCGTGGCGGTGGGTGGTCGACCCGCCCGATCTC
ATCTTCAACGGGGTCAAGGCCAACCACTACCAGAAGATCAGGACTCTGCGCGGCGTGCCTGGCGTGCGTGCCGAGCGGTT
TGCCGAGGCGATGCGCATCCGGCACTGCGCGCTGTCGCTGGTGGGCGAGCCGATCTTCTACCCGCACATCAACGAGTTCT
TGGGCATGCTCCACAGCGAAGACATCTCATCCTTTCTGGTGTGCAACGCGCAGCACCCGGACCAGCTGGCAGCGCTGCAC
CACGTTACGCAGCTGTACGTGTCGATCGACGCGGCCAACCGGGACTCGCTGCGCAAGATCGATCGGCCGCTGCACCGCGA
CTTCTGGGAGCGGTTCCAGCGCTGCCTGGAGATTCTGCGCGAGAAGCGCTTTCGCCAGCGGACGGTGTTCCGGCTGACGT
TGGTCAAGGGCTTCAACATCGAGGACGAGGTGCGTGGCTATGCGGATCTGGTAGAGAAGGCGCTGCCGTGCTTCATCGAG
ATCAAGGGGGTCACGTACTGCGGCACATCCACGTCTGCCGGTGTCGGGCTGACGATGGCCAACGTGCCGTTCTACCACGA
GGTGTGCGACTTTGTGGTGGCCCTGGACAAGGAGCTGCGGGACCGGGGACTGGCGTACGGACTGGCGGCCGAGCACGCGC
ACAGCTGCTGTGTGCTGATTGCGAGCGAGCGCTTCCGGGTGGACGGGCGGTGGCACACGCTGATCGACTACGACAAGTTT
TTTGCGCTGCTGCGCGAGAAGGGACCAGACGGCGACTTCTCGCCCGAAGACTACATGGGCGAGGCAACACCGGAATGGGC
CAACTGGGGTCAAGGCGGCTTTGACCCGCGTGACCAACGGGTGGATCGCAAGGGTCGTCCAATCATGGCGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62