GenePrediction:GLEAN_2555 Details

Name: GLEAN_2555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1826682..1831133 (+ strand)
Length: 4452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1826682..1827005 (+ strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_140:1827069..1828045 (+ strand)
Length: 977
Type: CDS
Source: GLEAN
Position: GCSC_140:1828178..1829107 (+ strand)
Length: 930
Type: CDS
Source: GLEAN
Position: GCSC_140:1829660..1829954 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_140:1830040..1830081 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_140:1830169..1830808 (+ strand)
Length: 640
Type: CDS
Source: GLEAN
Position: GCSC_140:1830870..1830942 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:1831003..1831052 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_140:1831111..1831133 (+ strand)
Length: 23
>GLEAN_2555 class=GenePrediction position=GCSC_140:1826682..1831133 (+ strand)
ATGCTGCAGGTCGAGCGACCTCCAGGGCAGCAGCACGTATCCACCACGCTTTCGAGCAGAAGACAGTGCCGCGTTAGGAT
AGCGGCTAGCGGCGACACATCAGCACACAGCATGTCGGAGGACAGACTCAAGATCTCGCTGCGCAGCGGCACCAAGCGGA
AGACGAGGCCAGTCATCAGCGCCCCGAGACAGATATCGGCACCGATCATCAACAATGGCCCACCGGACAGTGTTTCGCGG
CTGGCGGGAGGAGCAGGGTCACGGCCGGCAGCCGATGCGCAGGTGGCAGCACGGCCGAGGCCACAGCCGCAGTCAGGAGG
AAAGGTGTGTTTTTATTCGGTGTTTGTTTTGGGTTTCCCATGATGGAAGAGCTCTGACGCAGAACAGACGTCGGACCTGG
TGAAACGGCGGTACTCGACACGGTTCAACGACATGCCCGGTCACGAGTTTGCCCCTCCGGTGCCGTCGCTGCCGTCGTTT
GACCGATACGAGTCGTCGACCCGAGACCGACGGCAGGGCGGCAACGGGCTGCCAGCATCACGCGGGCGCGATGACCGAGG
ACTGCGCAGCCGCGGCGATGGCGGTGGGAGCGGACCTGGCGGGTTTCCAGGCGGGTTTCCAGGCGGCGGCAGCAGCGCGC
CGATTCCGGTAGACGTGAAGGCGCTGCGCGACCCGAAGTTGGCGGCAGACCAATACGTGGCAAACATGTTGAGCGACGCG
TCGGAAGAGGAGATCCGGCGATACGAGGAGGCGTTGCGCAATCTGCGAGCTCGAGCTTCGGCCGACCTGCAACAGAACAT
CTACCAAAACCGGTCACAGTTCATCAAGATCAGCAAGGAGGCCGAGAAGCTCAAGGGAGAGATGCGGACGCTTCGGAACC
TGATGGCCGATCTGAAGACGAACACAACGGCGTTGCGATCGGCCTCGTCGGCCAGCAAAGGTGCAGACGGGATGGCAGGC
AGCAGCGGTGTCAACGGCGTCGGACTGAGCGGCACAGGGTTCGCGACCGGGCTCAGCAAGCGTGATAAGCGTAGCTCGGT
GGCGGATCGATCGGCGTTGTGGAACGCGCAGATGCAGACGCTGTACAAGACGGTCGAGGGATCGCAAAAGTTCCTGCCCA
TGTCGATGGGCCGCCACGTGGTGCAGAACGCGGGCCAATGGATCGAGCTGGACAACGCGACATACAAATCGCGGAGGGCA
ATGCAGATATTTTTGCTCAACGACCACCTGCTGGTGGCCTCGCGCAAGAAGCGCAAGGTCGAGGGTCCGGGCAGCGGAGG
CACCGGACCGATGCTAAAGCTGGTGGCCGACCGCTGCTGGCCGCTGCTGGACATTGAGGTAGTCGACATGGCCGGCTCGG
GCGAGTCGGCAACGGGCACCATCACAAGCACAGGAGGCGGCGGCACAAACGACAGCGGAGGCGGCAACAGTGGCGGCGGC
AACGGCAGCGGAAGCGGCAATGGCGGTGGCACGAACAGCAACAATAACGCGACCAGCTCTGGACGGTCGCGGCTGGCTGA
CGCGATCATGGTGCGTGGCGTGGGACAGGAGACGGTGATCTACCGGACGGAAAAGGGCGAGGACCCCGAGAAGGCGGCGC
TGCTGCAGAACATCCGCAAGGTGGTGGAGGAGCTGCGGCGCAACATTCAGTCGGAGATGGAGGCCAACAACCGGGCCAAG
GAGACGATCAACTACTTTGCATCACGCGATCCAGGACTGCTGCAAAAGGCCGACCTGCTGGAGACGCTGTCAGACATCAA
GGACATGCTGATCGAGGTGGACGGGAAGCAGCAGAACCTGCGATGGGTGGAGAGCCAGATGGACGAGCTGGACATTGACA
TTGCACTGCAGCAGTTTGAGCCGTCGGTGGCGCGAGTGGAAAAGATCCAGGCGCTGGCACGCGGATTGAAGAGCAACGCG
GTGGCCCAGGACTTTATCGAGTTCAAGGTGGAGGAACGATCAGCACGGCTGGCGGCGCTGCTGATCCGCGAGCTGGTCGA
CACGCACAGCCAGCAGCGCAAGACGCAGCGCAACGTGTCGTGGCTGACGCGACTTGGCTTTGAGGATCGCGCGCGGGAAG
CCTATCTGGAGGCGCGCAGCGGCACCATCCAGAAGCGGGCGCGCCAGTGCATCTTCCAGGGCGACCTGCACCTGTATATC
TGGGAGCTCTCGTTTGTCTGCTTCAGCGTCATCCGCAACACCGTCGCCTGCTTCCAGAGCTGCTTTCCGCCGGCTGTCAT
GAGCGCCTGCGTCAAGTGGGCCAAGGAGGAGGTCGAGGCCTTTAATCGCATCCTGGCCCGCCAGCTGAGCAGCACCGAGC
GCGGCGGTGACGTGTGGCAGCGCTGCATGGACCAGGCCCGCGAGCACGCCAAGATGCTGGCCGACGTCAGCCTCGACTTT
CGCAACCTGGTCGGCCAGGGTCTGGAGTGAGGGTGAAGGTGAGGTTGATACGAATACTCTGTTGTGCTGCAACACGCTCT
TGTTCTCCTTTCTGCTTTATGGCGCTTCTCCTTCTGTCTAGCATAATGACCTGCAAAATGACATGTTGTACGTTCTAGAA
GACATGCTCACAGTGCGAATCGTCCATACGAGCCCATACACACCGTGCAGGCACACTAAGCTTGCCAATTACATATACCC
CGCCTAAAATGTACTTATCAAGCGCACGGGGGGACGCTGGGACCACTGAGACGGGCTGCAGCCAACACACAATTCCGCGC
TTGTTTTCCCGCTTCCCCCTCGTCCCCGGTTTCCCTTGCTTCACCACATCAATTGGAGCCAAAACATCGACAGCCACAAA
AGCTTTTGTTGCCCTCGCAGCATCACGCAGCGACCGACGAGCGCCCGCCCGCCCTTCTTTCTCCCTTTTTTTGCGTCTTT
CCATCGGCGACCCCGATTTTCGTTCGTCGCCACGCCAGCACCCCGCGATAGATAAACAAGGGCTCGACCCCATCCCATCT
CTGGCCAGATCAAAACAGGAGACCGCATCGCCGGGCACGCCCCTTGATCTGCTTCGTCATCACACCCGGCCACCCATCCG
GCCGTGCTCGTCTCTCTCTGGTCTCGCCCAAGACCGTTCGATACGCTGATCCCCGCGCGCTGTGTCGCCATAGCATGGAT
ACGAACATGGAAGACGTCGGTCGCGGTCCTGCAGATTTAATGCCTCCCCCGGTTCTCGAACCCACAACCGTCCCGACAGT
AGATGGCTGGATCGAAAGCTTGATGAGCTGCAAGCAGCTGAGCGAGCTCGATGTCCAGAGGCTGTGCGAAAAGGTGCGTT
TCGGCGGCGCGGCTGCACACGCGATACGTGTCGCGACAGACGTGGAGCTGACACTGTGATTTTGTGCTTTTGACCTAGGC
ACGCGAAGTGCTTCAGGACGAGTCCAACGTACAGCCGGTGGTATGTCTTTTCCGTCCCTCTCTTCCGCTCCTGTCCCGCC
CCGTGTTGTGATGGCCCTTCTCACCCATGTCGCGCCTCTTGCCACAGAAATGCCCGGTCACCGTCTGCGGCGACATCCAT
GGACAGTTCCACGACCTGATGGAGCTGTTCAAGATCGGTGGCCCGAACCCGGACACGAACTACCTCTTTATGGGAGACTA
CGTCGACCGCGGCTACTACTCGGTCGAGACCGTCACCCTGTTGGTGGCGCTCAAGATCCGCTATCCGCAACGCATCACCA
TCCTGCGAGGCAACCATGAGTCCCGCCAGATCACGCAGGTGTACGGCTTCTACGACGAGTGCCTCCGCAAGTATGGCAAT
GCCAACGTGTGGAAGTACTTTACCGACCTCTTCGACTACCTCCCCCTCACCGCCCTCATCGACAACCAGATCTTCTGCCT
CCACGGCGGACTGTCCCCCAGCATCGATACGCTCGATAACATCAGGGCCCTCGACCGCATCCAGGAAGTGCCGCACGAGG
GACCCATGTGTGACCTGCTGTGGTCCGACCCTGACGACCGCTGTGGCTGGGGCATATCGCCCCGTGGTGCCGGCTACACC
TTTGGCCAGGACATCTCTGAAGCTTTCAACCACAACAACGGCCTGACGCTCATCGCACGTGCCCATCAGCTGGTCATGGA
GGGCTACAACTGGTCTCAGGATAGAAACGTGGTGACAATCTTCTCGGGTGCGTACTCGAGACACGGCTGCACAAGTCGAA
ACGACAGGATTCTGCTAACTTTGCTCAGCACCAAATTACTGCTACCGCTGTGGCAACCAAGCAGCCATCATGGAGATCGA
CGAGCACCTCAAGTACACATTGTCAGTACTCTCGGTTCCCTGCCTAGACAGGTCTGCTTGCTGACCCATTTTTCTTCGCA
GCCTACAATTCGACCCTTGCCCTCGAGCAGGCGAGCCTATGGTCTCCAGACGTAAGTCCTCGCCTTGCACGTGCACACGG
ACCGGAACCACGAGTCTAACCCGTCGCAGGTACTCCGGACTACTTCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62