GenePrediction:GLEAN_2556 Details

Name: GLEAN_2556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1837647..1839506 (+ strand)
Length: 1860
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1837647..1837732 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:1837786..1837869 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:1837930..1838092 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_140:1838145..1839506 (+ strand)
Length: 1362
>GLEAN_2556 class=GenePrediction position=GCSC_140:1837647..1839506 (+ strand)
ATGACAGGTTGTATTTCGCTCGAGGGCTCGACGGAGTGTCCCGCATTTTCGTCATCGTCCATTTCTACCACTGCTAGCCA
GGACTAGTAAGTGCTCTGCCGTGCCGACTTGATATGTCTATCCAGCTGACGTTTCAAAGTAATTTCCTCCAATATGTCTC
GGACAGAGCCGGCTTCGACTCGGCTCTCGCCTCATATGTGCAGACAAGCTATGTTCAACAACAGTACGGACTCCCAAACA
CTAAACACTCCTTGTTCAGGACAAGAACTGACTCTCCGTCCAGATTCCAGGAGCGCCTCGGTTGCCATGGTATCGATCTC
ACGAATACCAGCAATCTCTATCCCCGATTTCTCAAGTCAACCATCTGCAGCAGTCTTGTCCAGGCCTCAGTATCGGCTTG
CAACCTGACTTCCGCAAAATCTCGCCCGCTCTGCGCAGACTCATGTGTACGTACCCTATGTGGCGCTTATTGCTCTGCTT
GCACTAACATTTGTCCAGGCCGAGTTTGCCGAGAGCGAAGCCTACATTCTGGCCGATAGTGCCCTCTGCTACAATACAAC
GTCGGACGCACAGCAATTGATACGAGCGGACTTTACGACCTGCGCACTTCCAGACGATTCACTCTCCACGGCACAATGCA
TCTCCGGCACTGACAACGAGCCGGACAACTGCGGTTATGGCAATAGTACTATTGGGTTGTGCTCATACTGCTCGTCTGGC
GGTATTAACTCCACCGACACGTGCTGTTACTCAGCCAATGCGTCAAGTAGATGCGCCGATGTTATCCTTCCCACCATTAC
CACGACGATGACATTTGCTACCGTGACCGCATCGGCTACCACAACCGCAAGTGGCAGCTCTACGGGGCCGGAGCATAGTG
TCCACAAAGGCCTTTCCGGTGGTGCTATTGCTGGAATTGCTATTGGATCTGTTGTAGGAGTTGCCTTGTTGGCGTTCCTG
GCGTTCCTGGCCCTTGCGATTCTGAGACGGAGACGGAGCGGGAGTCAAGACGGGAGCGTTTTCAACCAACCATCGCCTGC
TAGGAGGGGGGCTACCATGTCCCAAATTGGAGCGCACTCGTCCCACGGAGCCCAGCGGCCATTCGACGTGCTTCCTGGTG
GCCGTATTGCGAGGATGTCGGCTTTGGAAAGCCGTGATGAACGCAATTCGCCCACGCCTCCGGAACGAGGAGTGCCATCT
GCGGCTGCGTTGTCTGCTGGTGCTGCTGCAGGCTACTCGACACGCAGCAGCAGGCGACATGGTGACGACCGCTCGTCGTC
TGACGGCTTCCTCGACAGCCCGGATTCGGGGGTCCGAAGAGGCGTCTTGCGACCACCACCGACTATGCGGAGGACTGGGT
CTCTTTCGAGCAACTCCGTTCTCGCCGGCGAAGACCCGCAATCTCCTTCCAGCACTGGCGGGATGTCCTCACCACACGCC
TTGACCAGCCAGCAGTCGGAGCAGTTGCCTTTCTTCAAGGACTATTACTCACAGGACGATATCCACCCCGGCGACCGCGT
TTCTGTTCTATGGGCCTATCAGCCACGGGCAGCAGACGAGTTCACGCTGGATCGTGGCGACATGCTCAAGGTTGTCGGCA
TCTGGGATGACGGCTGGGCCACAGGTGTGATCGCTGATGAACGTGCCGAGGACTGGGAAGCCCGGAAACAGGCCCAGCGA
GATAGCGGGGTGTCCAACACATCAGGCCGCGGCCGGGAGATATCGCCGGCTGTCAGCGGCGAGATCAAGGCGTTCCCTCT
GGTCTGTGTCTGCCTTCCCGAGCACTGGCGAAAGACGATTGAAGGTGACGGATCGACTGAAACTGGTTCGAGTGGGAACC
AGGGTATTTATGGACCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62