GenePrediction:GLEAN_2557 Details

Name: GLEAN_2557
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1851243..1856989 (+ strand)
Length: 5747
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1851243..1851456 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_140:1851519..1856415 (+ strand)
Length: 4897
Type: CDS
Source: GLEAN
Position: GCSC_140:1856545..1856601 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:1856860..1856989 (+ strand)
Length: 130
>GLEAN_2557 class=GenePrediction position=GCSC_140:1851243..1856989 (+ strand)
ATGGGCCAGGGATACTCGGTCACGACGCCGTCTGCGGGGTCGGCCGGTATCGACGTGCCAGAGCTCGGAGACCTAGTCTA
CGAGAAATCACTGGGCAGCGCGCGGTTTATGAAGAGCATCCGGGCGCGACATCACGATGGCATCGCCCTGGTCAAGGTTC
TTGTGAAGCCGTACACGCCGATGGCGCTGGCCAGCTACCGCGACAAGATTCTGCGTGCGCATTTCCACGTGTCCTGCTGC
TTCTGCGTGATCTTGGCTGCTGACCATCTCCATCAGGCGAACGACGGATCCTGGCCAACGTGCCAAACGCGCTGGGGTAT
CAGCGCATAGTCGAGACGGAGACGAACGGGTACCTGGTGCGACAATTCCTGTACAACTCGCTCTACGACCGGCTGAGCAC
GCGCCCATTTCTCGAAGACATCGAGAAGAAGTGGCTGGCTTTCCAGCTGCTCTGTGCTCTGCGAGACTGCCACGCCCGCA
ATGTGTACCACGGCGACATCAAGACGGAGAACGTGCTGGTGACGTCGTGGAACTGGCTGTACGTATCGGACTTTTCGGCG
TCCTTCAAGCCGGTACTGCTGCCGGACGACAACCCGGCGGACTTTTCGTATTTCTTCGACACGTCAGGCCGTCGCACCTG
CTACTTAGCACCCGAGCGATTTGTGCCAGCTGCGGTGGCAGCCGAGGCAGCTCTGGGCAGCGATGAGTATGACGGCGATG
AGGGTCGCAGTAGTCGCAGCAGCCGCGGCAGTCGCAACACCACGTCGTCAGCTCGGCCAACCCGCATCACGGGGGCGATG
GATGTGTTTGGGGCGGGCTGCGTGATTGCAGAGCTCGTGCTGGAGGCCCCGATCTTCAGCCTGAGCCAGCTTTTCCGGTA
TCGTCGCGGCGAGTACGACCCGGCGATATCGCACCTCAGCCGGATGCCGGACCGGGACTTTGCGGAGATGATTGGGCACA
TGATCCAGCTGGACCCGGAGGCACGGTTATCGGCGGAAGAGTATTTGGAGCGATACCGCGGGACGGTGTTTCCAGACTAC
TTCTACAGCTTCCTGCACCAGTACATGGAGGTGATCACGGATCCATCGGGCCAATTCGCTGGGTCGGGAGCGACGCGCAA
CCTGGGCGAGGCAGACGAGCGGATTGACCGGGTGTTTTACGACTTTGACAAGATCTCGTACTTCCTGGGCTTTCAGGACG
TGCAGGGCGTGGCAGAGAAGGGGCCGTCGGGGCGGGCTCCCCGACCTCCACGGCTGGGGCTGGGACTGCTGCCAGTGCGG
CTCAGCATCCCGACCAAAGAGCACGACGTGTGTTTGGGGGCGCAACCGACTACGGACAACGGGGCGCTGATCTTCCTGAC
GCTGATCGTGGCGTCGATCCGAAACACGGCGCGGTCGGCATCGCGCATCCGGGGGTGCGACGTGCTGCTGGCATTTGCAG
AGCGGCTGAGCGACGAGGCTCGGCTGGACCGGGTGCTCCCATACCTGATGGCGCTGCTGACGGACCGGTCAGACATGGTG
GTGGTGGCGGCGGTGCGGTCGATCACGCAGCTGCTGGGGCTGGTGCGGACGGTCAGCCCGGTGAACGCACACGTGTTCCT
GGAGTACATCCTGCCGCGGATGCAGGTAACCATCCTCAAGGGCAGCATGGGCAGTGGCCTACGGGAGGCGAGTCCGGTAG
TGCGGGCGACATACGCAGCATGTCTGGGCTCGCTGGCGACGATTGCGAGCCATTTCTTAGAGATGGCGGCCAAGGCAGAC
CGGATGGCGGGAGCAAGCTCGGAGGCGGACGGGGATGGCAAGCTGGGGACCGGAGTAGACGGCAGCGACAACAGCGGCAG
CGGCAGCGGCGATGTGGCCGGGGTCACTCTGGACGGGCTGTTTGACGCGGCACAGAGAGACCTGTTTGAGATGTTTGAGC
AGCACACCAAGGCGCTGATCGAGGACGCAGACCCGTATGTGCGACGGGCCTTTGTGACGTCGGTGCCGGAGCTGTGTCTC
TTCTTCGGGGCGGCAGACGCGAACGAGATTATCGTGACGCACCTCAACACGTATCTCAACGACCGGGACTGGATGCTGCG
GTGTGCCTTCTTCGACACGATCGTGGGGGTAGCGACGTTTTTGGGCAGCGTCAGCCTGGAAGAGCTGATGCTGCCGCTGA
TGATCCAGAGCCTGACAGACCCGGAAGAACACGTGGTGCAGGCGGTGCTGCAGGCGCTGGCCGAGCTGGCCGAGATCGGG
CTGTTCTCGAAGCCGATGGTGTGGGAGCTGGTGGAGATGGTGGCACGGTTCACGATGCACCCAAACATCTGGATCCGGGA
GGCAGCAGCGCGGTTTTTATCGGCGGCGACACGGTTTCTGTCGGCAGCGCAGGTGCGGTGCATGTTCATGCCGCTGGTGG
CGCCGTATCTGAAGCCAGGACTGTCGGGCCTCAGCTGCTCGGAGCTAGACCTGCTGGACCAGCTGCAGCGGCCGCTCTCA
CGGGCGGTGTTTGAGCAGGCACTGGCTTGGGCGACGAAGACGGACCGGGGGCTCTTCTGGAAGCCGCTGCAGAAGCTGCG
GGGATTTCCGTTCGGCATGTCGTCGGGGGCTTCAGGGAGAGCACGAGAGGCGATTCCGCGGACGCTGGCCCGGATGGCCC
GCAACGACGAGGACGAGCAGTGGATCGGACGGCTGCGCAACCTAGGGCTGACGGCCGAGGACGAGTTCAAGCTGATGGCG
CTGCGGGAGTTTGTGTGGCGTCTGGGCCGGCTGAAGCTGCACGAAGCAGCCAGCAGCAGCCAGGCCGAACTGGCGAACAA
CAGCAGCAACATCAACGGTAGTGGGAGTGGCAGCAGCAACAGTCCCAACCTCAACAGCATAGTGGCACTGCGCAGCCTGG
GAATCGCAGTGCTGACGGTGCTCTTTGACGACGAGCCGCAGAAGCAGATGCGGGCAGCCGGACTGGCGAGCAGCCTGGTA
GCAGCGACGGCGACGGCCATGGGACTTGATGGCGGTGCGCCACGGTCGATCGAGGACGCGCTGCAGGATGCATCCATGAC
GATCGACGACCCGATCTCGCGGCGACGCCGGGCAGCACTGAACGTGCACCGATCACGACTGAGCAGCCAGAGGGACAGCA
GGTCGGCAGTGCAGGGAGGCATCCTTGCCGGAGAGGCAGGCGAGACCGGAGAGATGGGAGAGACGAGAGAGACGAGAGAG
ACGAGAGAGACGAGAGAGACGAGAGAGACAGAAACGGCAAGACCAGGGTCTCCGGCATCGACAGCCGCAGACGATGCATC
AATGTCGAGCAGACGCAGCAAATCAATACTACAACAGCGATCGAGCGCAATGAGCCTGCTCAACCGGCGAGAAAGCGTCA
AGTCGGGGGCCGAGACGGCGACGACGGAGACGAATGCGTTTGGCCAGGTGGAAGGTCGATCGGCGCTGATCAGCGACATC
CCGACCCGATCGCCGGCACCATCAGACGACGACAGCCTGACCAGCGGCACGGCCATGGCCGATGCAGCCGAGGCGAGATA
CAGGGCTCATCACACGTATGCTGGCAGCGACCCAAACGTTCTGAGGATGCTGGATGCCATGTACCACGAGAACTACCCAC
ACGACGTGGCCGAGTTCAGCCCAATGGTAGCACCGGTGTCGAGGAGGAAGATGGCAGCAGCAGCAGCAGCAGCAGCAGCG
ACAGCATCAGGTAGTGGTGGTGGAGGCATTGGCAGCGGGCTGCGACGATTTGGGGGTGGCGGAAGCGCAAACGGTCACGG
AAACGGAAACGATGGCAGAAACGGCAGCAGCAGCCAGACAGACGTCTGGCGGCCAGCAGGACAAATGGTGGCAACGTTTT
CGGAACACACAGGCGCCATCAATCGGGTGGTGGTCTCGCCCGACCATGCCTTCTTCCTCACGGGCGGCGACGACGGCACC
GTGCGCGTATGGGACACACAGAGGCTGGAGCGCAACATCTCGCACCGGTCGCGACAGGTGTACCGGCATTCTGGCGGTGG
TCGTGTGTTGGCGCTCTGCTTCATCGAGAACACGCACTGCTTTGTCAGCTGTGCGAGCGACGGCAGTGTGCACGTGATCA
AGGTGGATCACGTGCCGGGATCATCTTCGTCGAACAGCAACGGCAACGGCAACGGCAACGGCAGCGGCAGCAGCAACAAC
GGCGGCGGCGGGATGCCGCGGTACAACCGGCTGCGTCCACTGCGCGAGTACCAGCTGCCACGCGATGAGTGGGCGGTGTG
GTGCGAGCACTTCAAGCAGGAGGCGAGCTCGGTGCTGGTGCTGGCGACGAACCGATCGCGGGTGCTGGGCATCGACCTGC
GCACGATGACGTTGCTGTTTGCGCTGGCGAACCCGGTGCACCACGGGACGCCGACGTGCTTTGCGGTGGACCGGCGACGC
AACTGGCTGGTGGTGGCGACATCGCATGGCGTGCTGGACCTATGGGACCTGCGTTTCAAGATGCGGCTCAAGGGCTGGGG
CGTGCCGGGAGGTGCGCCCATCTATCGGCTGGCCATTCACCCGTCCAAGGGCCGGGGCAAGTGGCTGTGCGTAGCCGGCG
GGACGGGGCACGGCGAGGTGACGGTGTGGGACCTGGAGAAGACGCTGTGTCGAGAGGTGTATCGGGTGGGAGGAGGTGGA
CCGATGAATGGGAATGGAAATGGGAATGGAATCAGCACCAACGGTACTAACGGAAGCAACGGCACTGCTGCCAACAGAGA
GAACCTCATCAGGGGCTACGAGCCGTGGGATGTCGACGAGGACCGACCCGAAAGCATGCTGGGCCGGTTTGCCACGAGCC
TGGACCCGGCATCGGTGGGAACCGGAAACGGAGAGGCCGGAGGCAGCAGCAACAGCAGCAGCATCAGTCCCGGTGTGCTC
GGCGGTGGCGACAAAGGTGTGCGGGCCATGGTGGTGGGCTCGGCGACGTCGGACGACACGCGCGACGTGCGCCACGCTTT
CATCGTCACAGGTGGCAGCGACAAGAAGCTGCGCTTCTGGGACCTTTCGCGCGTCGAGAACAGCGTCGTGTACAGCGGCC
TGCTGCCAGACGAGCCGCGTCCGACCTTTTCGTCCCTGCAGGTGACGACAGCCATGACGGTCAGCACGGAGCGGCTGCCG
CGGAGCGACGGCGGTGTCGTCGGCCTGTCACAGACGAAGAAGGGAGCCAAGCGGTCGGCCAGCGGTGGAGCCAACGGCAG
CGGAACCAACAGCAACAGCAATGGCAACGGCAGCAGCAGCAGCAGCGTGCGCCCGTCACGGTCTACCGTCATTGCCATGC
AGCAGCAGCAGCTGTTGCGCAGCCATCTGGACGCAATCCTGGATGCGGCGCTGCTGGAGAGCCCGTACACGGCAACGGTG
TCAGTAGACCGAATGGGGGTGATTTTTGTGTTTTCGTAGGGAGGACGGAGTCGGAGGACGGAGGAGTCTGTATGCGTTCA
ATGTATGCGTGTATGCAAGTATGTGATATAGAACTTATACAGTATAATTCACCCTTATACGACTATGCAGTATAACATAC
CTGATAACCATACCATTTAGCCGTAGTGGAGTGTGTCTCGGAAAGAGGGCCGGCACGAACTGGTCGCCCAGTTTTAGCCG
GTGACAGCTCGCACAAGAGCCACCGTCCGACCGTGCGGCCAGTTCGTGGCCGCGCCGGACTGGCTTCTTCCATCTGCGAC
CGCCCTGCGACCGACCTGCGACTGGCGGAAAGAGGAATACGAGCGCGTCGACTTGTGCTTTATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62