GenePrediction:GLEAN_2558 Details

Name: GLEAN_2558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1858565..1859821 (+ strand)
Length: 1257
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1858565..1858734 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_140:1858799..1858986 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_140:1859097..1859301 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_140:1859356..1859821 (+ strand)
Length: 466
>GLEAN_2558 class=GenePrediction position=GCSC_140:1858565..1859821 (+ strand)
ATGGCCGACTTGGACGACTCGTCCGACTTCATAGAGCCAGCATCCGATAATGTTTCTCTCCGCACCGAAGAGCTCGCTAC
CGTTACCTCTGACTACGAGCCCACCCTGAACGAATCCTTGGTGGGCTCGCTCACATCCAGCGTATACGCTCACGTATACG
AGAATGGGCGGTGCGTTTGTGTCACTCTCCCCCTGTACAGCATGCGGCTCTAACCCTTCTTCTCGCTCGCCTAGCCGCTA
CCACATGTATAAGCAAGGCCTGTATCCCTTGCCCAACGACGACGGCGAATATGGCCGTGAGAGCATCCGCCATGCCCTCT
TCCTGGACCTGCTCTCGGGCAGGCTCCATCTCGCCCCCATTGGAGACAGTCCGCAGAAAATCATGGATATCGGCACCGGC
TTTGGCGATTGGTCCATCGAGAGTACGTAGAGCTTGGACGTGATCCAACAGCGAGTGCGAACGTCCGCAGAGGTAATGAG
AGACCCAGACTGAGAACTGAGAGCTAAATCGCCACCTTCGGAACACTTACAGTGGGCGACAAATATCCCAGCGCAAGAGT
CATCGGCCTCGACCTCTCTCCGATTCAGCCCGTGTGGGTGCCGCCCAACGTGGAATTTGTCGTCGAGGACGCCGAGGAGG
ACCAGTGGATTCACGGCAACGATTTCGACTTCATCCACTTCCGCGTCGCAGCCGTTGTCCTCAAAGACCCCATCCGCGTG
GCCGCCACTGCATTTGAGTAAGTCGGCCTGGGAAGATGCAGCTTGGACAGCAATACTGACGGCCGGAACAGCAACCTGAA
GCCGGGCGGCTGGATCGAATTCCAGGAAATTCTCCCTCGTGTCGGCTGCAACGACAGCACCATGCCCGACGACTACGCCA
TGCAACGCTATTATCACACCGTCTGCGACATCATGGCCCGCAAGTACGGCTGGGATGCCTTCGTCGCCGAGCGGCTGCCT
GTCGAGCTTGAGCGCATTGGTTTCGTCAATATCCAGCGCAAAGTCTACCACGTGCCCATCGGCTTCTGGCCCAAGGACAA
GAAGCGCATGCACCACGCCTTTCTGTACCGCGAAGTCGTGAACGATACGATGCCTGCCCTGCGTGCCAAACCGCTGGTCG
GAAACGACGTTGGCTTAACGCCCGACGAGATCGACAGCCTCTTCGCCGACACCCGCGCCGCACTCTGCCTTAAGCGTGTC
CACGCCTACGTTCCCTTCCACTTCGTCTGGGCCCAGAAACCGCAGCGCATGAGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62