GenePrediction:GLEAN_2559 Details

Name: GLEAN_2559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1863843..1865632 (+ strand)
Length: 1790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1863843..1864100 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_140:1864174..1864341 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:1864399..1864757 (+ strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_140:1864815..1865433 (+ strand)
Length: 619
Type: CDS
Source: GLEAN
Position: GCSC_140:1865507..1865632 (+ strand)
Length: 126
>GLEAN_2559 class=GenePrediction position=GCSC_140:1863843..1865632 (+ strand)
ATGGCCCTACAAGCCATATTTTGGCTTGCCGACTCGGCCTGTGTGCCGGGTGCCCTGGTCCTGGGCGTGGCCATCGTCAT
ATACACAGCAGTGGCCTGGTTTGCATCGTGGGCCCGCCTCAAGCATATCCCTGGGCCGCCTGGTGTCGGTCTCAGCAAGT
GGTGGCTGCTGCGTAACAGTCTGCATGGATCCCTGTATCTGGCCAACATGGACGCATGCAAGACTTATGGCAAGTGCAGA
GCTGTCGATGGCCGTGTGGTTTGTGTTGCCCGCGTGTATTAACATTGTTGTTCTCGTCCAAGGCCATCTTGTTCGCATCG
GCCCCAATCAGCTGGTCACCGATGACCCGGACGTGCTACGGCATATATGGGCTGTGCGCTCGCCGTACAAGAAGGGTCCG
TTCTATGAGGCGGTCCGGTTCAATCCCGAGCGGGACAACCTGGTCTCGCTGCGCGATGACCGGGCACATGGGACGCTGCG
GGCGAAGATGGCAGCAGGAGTGCGTTGTCTCTCTCGACCAGTACTGGGCAGGCGGTTGCTGACAGAAGACTCACAGTACG
CGGGGAAGGAGAACGAAAGCCTCGAGTCCTCGATCGACCGGGAGATTCTAGCGTTTGTGGACCTCCTTGAGCGCAAGTAT
ATCTCGACGAAGACGGATTTCCGGCCGGTCGATCTGGCCCACAAGGCTCAATACCTCACGCTGGATGTCATCACAGCGCT
TGCATTTGGGAAGCGGCTGGGATTTTCGGAGCAGGACCGGGACCTATACTCGTACATCAAGATGACAGAGGAGAACATGC
CAGTGATGATGTTGATGACTATCTTTCCGCAGCTGGCCCATTTGATGCAGTCTCGGCTGTTCCGGTGGATGATGCCGTCG
GAAAGGGATCGGGTGGGCTTTGGGGCGTTCATTGCGTGAGTTCTTCCGGGGCTTTGTTTCTTCTTCTTCTTCTTCACTGA
CGTCTGACACAGTGTGGCCAAGGAGATCGTCAGCGAGAGGCTGGCGTCGGACAATCCTTACCAAAAGGACATGCTAGGGT
CGTTTCTAGCGCATGGGCTGACGCGCGAGGAGGCCGAGGGCGAGACGTTGCTGCAGATCATAGCAGGCTCAGACACGACA
GCGACAGCGATTCGGTCGACGATGCTGCATCTGATGTCGTCGCCGCGGTCCTACCACCGACTGGCCACAGAAGTGCGTGA
AGCATCGGCTCAGGGCCGGATCTCATCGCCCATCACGTATGCCGAGGCGCGGGCAATGCTATATCTGCAGGCGGTGATCC
AGGAGGGTCTACGCATCAACCCGCCGGTGGTGGGTACAATGGATGTGGTGGTGCCAGAAGGGGGCGACGTGCTCTGTGGG
CTGCGGGTCCCAGCGGGCGCGGAGGTGGGCTGCTCCATGTTCAGCCTGCAGCGACAGACAGCCATCTTCGGGGCAGATGC
AGACGTCTTTCGGCCGGAGCGCTGGCTCGAGGCAGACGAGGACGTGCTCAAGGAGATGGCTAGCACGTGGTCGCTGATCT
TCCGGTATGGCAAGTGGCGGTGCCTCGGCAAGGACGTTGCACTTCTGGAGCTGAATAAGGTGTTTGTCGAGGTAGGTTCT
ATGATCTTTGTGATCTGTGTGCTTTGTGTGCATCGTGTCGTTCTTTTCCTTGCTGACAAAATAGCTGTTGCGGAGGTACG
ACTTTACGCTGGTCAATCCAGCAAAGCCGTGGGACTCGACCAATGCGGGCATCTTCATCCAGTCGAATATGTATACCAAA
GTTACCCGGGTCGAATCGGTGAATGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62