GenePrediction:GLEAN_255 Details

Name: GLEAN_255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:575089..577798 (+ strand)
Length: 2710
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:575089..575100 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_167:575560..575720 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_167:575970..576807 (+ strand)
Length: 838
Type: CDS
Source: GLEAN
Position: GCSC_167:576865..577404 (+ strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_167:577490..577798 (+ strand)
Length: 309
>GLEAN_255 class=GenePrediction position=GCSC_167:575089..577798 (+ strand)
ATGGATGCAAAGGTGAGCTTCTCTAACTCTTTTTTCCCATGCGGTGCTTGAATGTACCCGCTTTTGTTTTCCGATCGCTG
CCCTCCTTTCGCTTGGGTCCTGGTGGAATTACAAGGCTTACAAGTACGCTTGTATCAATATCTTTGCTACTACCCTGTGG
TCCCTCCTTCGCATGCCATTCACGACTTTCTGAATTATTGACCCACCCACCCCTTCCCCTTCTCATTTCTCATTACTCTT
ACTACCAGATCCGCGTTGTTGGTCCCTGCACATCTGTATTTTCTCGACGGGTGCCTCTGTCGCGTCCCCCCTGTCCTTTC
TCTAGATTGCTGGCATATACCCACTCCATCCGATCGCATGCATTCGCTGTCACCTGCAAAAACGCTTTATTGCGCATATG
AGATACATCATGGAACAAGGGCTAACCAGTGGGTTTCACCGCGTCAGCCTCAGCGCCTTTCACGGTCACAGCCTAGCTTC
GGCCAGGCCAACAACGAAAATATGATTCCTGCTGTCTTTGGCGTGGACCAACGAAACAAGGCTCCCGGTGTTCCCATTGC
CAAGTCTGCGGCAGAGGGCCTCAGACCCAACGCAAAACGGACAGCTTTTGGGGATGTCAGCAATGTCCTGAGGTCTGTTC
CTGACATGGCTTTCTTTGGGTTCAAATCCACTGCAATTGCGGGCAACACCGCATCCGTGGTCCCTTCTGCTACTGGCGGA
AAAAGAAAAACACGGCTCAATCTGCCGGCTTTCTGGCACCTGCACAACGCGCAAAGATCAGCGGCTCTGTTGTTGCCTTG
GCCACGGCAGACACAAACATTGTGCGGCCTCAGCCGACGCACAATGAAAAGTCCCAAATTGGTGCTTTGAAAACAGACCA
GCGTAGTCTTCAGCACCAGCAACGAAATTGGTAAGGTAGCCGGAACACATGCCACTGCCGCTACGCTCGTGGATGGCAAC
TACCCGGTGTCAGCTTCATTGGCCCAGCATAGCAACGCCAATAGGGCCAAGCAAAGCCCACGGCAGCACAAGAGCCAGCC
CTGCCTTAAGAGCGCACTGGACCAGCAGGTGCAAAAGAAGATTCTACGCCGAACCCAGAGCCGGCTTCCGGAAGACCGTC
CGCAACTGAAGGATGTTGTCGTCTTCACTGACTACAAGACTGCTGCCGGTCTCGAGCTCGATGGTCTCAGTGAAAGCGAC
TTTCACGACGCCGATGCCGATGATGCACCATATGTCAACGCTGTTGGAGCCATCAATAAAATTGTGATGCCTGCTTCGGA
CAACAATACCGGCAATGTTCGGGCCCATGACGAATATGTGGCAGTCGGGGCTCACCAATTACTAGAGCAGGCACCACTGG
CTCAGAGCGAATTTCACACGGCGGACGAAGAACATCTGGATTTTCTCTCAGAAGTTCCCACAGTTCCAACTGGTGGTGCC
GCTGAAGCAGAAGAGCCTTGGGAGGACGACGGCGATTTTTACGAGGAGCAGGGCTACACAACCGCTCACTCTTTCCGCTC
ACTAGGCGACAATACGACGGGTGGCTCGACAACTATCATGATGCCCAAAGTGACGGCTAGGATCCAGAACGAGTTGGATC
TTGCCCGGTCCATTGTCGAGGCGTCCCTTACTCCCGAGGAGATCGACGACGAAGCATGGGACATTAGTATGGTCGCCGAA
TACGGAGAGGACATCAACGACTACATGCGGGAGCTTGAGGTAGGTTTCTTTGCTCTTCTCCCTGCAGGAAACTATGAGAG
ACTGACTCATGAATAGGCAAAGATGCTTCCTAGTCCTCACTATATGGACATGCAGACGGAGATCCAATGGTCGATGCGCG
CCGTGTTGATGGAGTGGTTGATTCAAGTCCACGCACGCTTCAATCTGCTGCCGGAAACCCTATTCTTGACGGTCAACTAC
ATTGACCGGTTTTTGTCGTCCAAAATCGTGTCCGTGAACAAGCTGCAACTGGTCGGCGCCACAGCTATTTTCATCGCAGC
GAAATACGAGGAGATCGTTTGTCCGTCGATTCAGGAGATCGTGTACATGGTCGACGGCGGTTACACTGCGGACGAGATTC
TCAAAGCCGAGCGCTTCATGCTTAGTATGCTTGGCTTTGAGCTTGGTTGGCCCGGTCCCATGAGCTTTCTTCGTCGCATT
AGCAAGGCCGACGATTACGACTTGGAGACACGGACTCTGGCCAAGTACTTCCTGGAGGTGGCCGTTCTGGACGAACGATT
CGTGGCCAGTCCAGCCAGCTTCTTGGCTGCCGGATCTCACTGCCTAGCCCGCCTCATGCTGCATAAAGGCGATTGGGTAA
GTCCCTCGAGCTCTTCCTGTTTTGACGCCCACCCGTGCTATTTTTGCCTGTTGCAGCTTGTGCTAACAATGCATCATACA
GTCTATGGCCCACACACACTATTCTGGTTACACATGGGGCCAGGTCCGGCCATTGGCCAATGTGATGATTCATTGCTGCC
GAGATCCACAAGCACACCATGCAGCTGTTTACGAGAAGTACGCCAGCAACAAGTTCAAGAAAGCATCCATTTTTGTCGAG
GAAGAGCTCCGCAGAGGTTTTTCCATGCCACCTCCGCACATGCATCGGCAACGGTCGTCACTGACGGACTCGTTTACCGA
CAACCTGAGCGATTCCATTGGACCGCTCCGCTCCAATCACCTGGACATACTGATTCAAGCGCAAAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62