GenePrediction:GLEAN_2560 Details

Name: GLEAN_2560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1876734..1877308 (+ strand)
Length: 575
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1876734..1876793 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_140:1876858..1876893 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_140:1876961..1877098 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:1877168..1877308 (+ strand)
Length: 141
>GLEAN_2560 class=GenePrediction position=GCSC_140:1876734..1877308 (+ strand)
ATGACAACCACCCAGGCGGACTACAAGGACAGGCAGTTCCTAGCTGTCATTGGGGACGAGGTGAGCGGTCTGAAGCCACC
GTTTCGGTGATCGAGCCTGTCGCTAATGTTCGCATATGGCTTAGGACTCAGTGACTGGGCTGCTTCTCGCAGGCATTGGC
GTAGGTGCCCCGTACTGCATCCTGTACAATTACTTCTGTGGGCTTACCATGCATTTGTATGCGACAGCATGTAACACCGG
GGGCCGACCAGCAGAAGAACTTCCTCGTTGTCGACAGCAAGACGGACAATGCGGCCATTGAGGCAGCTTTCGAACGATTC
TCCACCGAGCGCAAGGACATTGGGATTATCCTGATCAACCAACATGTGCGTGGCAACCGTCAATGACGATGAAAATGCTG
TCGCTTTATCTGCGGAGACTGACATTCGGTGCAGATTGCCGACCGGATACGGCACCGGATTGACACATACACCGCGGCTT
TCCCGACAGTACTCGAAATCCCTAGCAAAGACCACCCGTACGACCCAGAGAAGGACAGCGTGTTGCGGCGTGTGAGGCGG
CTGTTTGGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62