GenePrediction:GLEAN_2561 Details

Name: GLEAN_2561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1882429..1884624 (+ strand)
Length: 2196
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1882429..1882656 (+ strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_140:1882885..1883033 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:1883157..1883518 (+ strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_140:1884083..1884624 (+ strand)
Length: 542
>GLEAN_2561 class=GenePrediction position=GCSC_140:1882429..1884624 (+ strand)
ATGACGTCTATTTGGCTTCGAGAACCTGATCGGATGCTGAAAGAGACCGGCCACGACTACAGCGAAATCTTCCACGAATC
TCCTTCTAGCAGCGAGTCAATGAACCGGCCGCCCAAGGTCGAGGTCAAGAAGCGCGTCATGGACCAAGACCCAGTTGTCC
GTTGGAGCTATCTAGCTGCGTCAGAGGCTGTCGATAAGGACGTCCGGCTTCTGGAGCTCAATGGCGAGGTTGGCTTTCAA
AAAGACTACTGTTCTGTACCAATGAATCGATACGAAGAGCTCTCCTGTCCACTTCCTTTCGTTTTCTTCCATCCGCTCCT
TCCGTTGTACATTGACACCCGGAGGGAAGGGTCCCTGGCACGATATGTGAGACGAAGTTGCCGACCCAATGCTGTATTGG
ATACATTTTTGTCAGGCGGGTCCGAATACCATTTCTGGCTTCTGAGCGATCGGCAGATAGAAGCCGATGAGCAAATCACC
ATTCCCTGGGACTTCCGGCTTCCACGCGAGGCTAGATTTCGGATGCTTCGCATCCTTGGACTAGGGGAGGAAGACAACAG
CGTGCTGGACGACGTGGATGAAGATGAATACAGCAGCATTGCTCGGTGGGTGCACCAGATATTATCTGAATATGGCGGCT
GCGCGTGCGACTTAGGGGCGGACTGTGCATTTGCTCGATTTCACCGAAATTACGGCAGCAGGTTACACCAAACACAAAAC
GGACACAGTGGCAACGGGGGCCACCATAAGAAAAAGGCCGCGCGCAAGCCGAAACCCCATGCGTTGTCGCCAACAAGCAC
CGGTCATGCAACGAACAGTCGTGCTGCTAGCGAGGGCCACCTGGACGATTTCGCTGAAAACGACAAGGCATCAACATCGT
CGCGCAGCAAACCTCCTAGTCGAGATATGACGCCCGCTCCACGCCAGGGGTCCTTCGACACATTGGGTATATTGACGGAG
CCGACCGACCGAGACAAGAGGAAGGTAGCGATGGTAGAAGTCTCGTTCCGGCGTTTGGAGCAGCAGCCGCCAAAGAAGAA
AAAGCGATTGTCTGATGGCGGTGTTTCGGAGAAATCGACCTCTAGTCACAGTAAGTCGAAATCGAAAAGCTCACCGGCGA
GCAGCTCGGCGGTGCTTCCATCAGCCGATGGCGGCCACACAGACCTTGCAAACGGCTCCAATGGGCGGTATTACACCGAT
GCAGGAACATCACAGAACAAGGTCGATTTGCCGGCTGGTGCTGGATCGCCTCAACCAAAGACTGGATCCGCACACGCCTT
TGCACCTATGTTGTCAGCTCGGAGTACCACACCTACGAACTCACGGCATACTTCGGTTGTCCCTCCGTCGACCTACTGTG
ATGCTAGTGTGCAAACAGATACCACAACAGGCGAGTGGTATAGCGAGAAAGCTGCTACACCACGTCCGAGGCGGAGGGTC
ATTTCACTCTCACGACGCCTACTAAGCTATCGACACCGTTTGCGGCCTGAAGGCAGCGGCGAAGTGAAACAGGGACAACA
GCAACTGGCGGCTTCCTCAGCCGCAAACACTGACGGTTGCGATAAAGGCCAGCCATCAGAGGCGGATGTGGCTGCAACGG
AAACAGAGTCATTATGCAGTGCGCAGACAGACGATGTTCCTATGACAGACGCAGCCGGCCATGCTGATGGTCCCGAAGCC
GAGTCGCCAGCCCGGTCGTCTTTGGCGACCGCGACACAATTGGCAAGCTCGAATGCTGTCAAAGACGACGCTTTGGTCAA
AATTCCACCGAGGAAAGCACCCGATCTCCGAGTGCAGATGCCGCAGGTGCCGGCTTTCAGCGACGCCATTGCCTCGAGCT
CAATATCAGTAGCGACGCCCGTGTATAGCTCGTCGAAGGCGCAGTCGCCATTGAGTGCAGCGAGTGCGAGTCCGTTCGGC
TCGTTAGCCGTCAACGGGGCGGCCCTGGCAACGCCTAGCCCTGTTAAGAAGAAGATGAGCCTGAGCGACTACACCAAGAG
TCGCAAGGCTGCGGGTGGCCGTCCGTTGGTGGGAACGTCTTTGAAGCCGTCGATATCAGGTGCGGAAGAACCAAAGTCTG
CTACGAGTGCGGATGGCATGGGCCTGGGCGACTCGCCGGCGGTCGGCGAGAAGCCGGGTGATGCTTCCTCGGCGGCGATG
ACGGTGGTGGCAACGCTCGTGGCTGGCTCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62