GenePrediction:GLEAN_2562 Details

Name: GLEAN_2562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1887677..1889560 (+ strand)
Length: 1884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1887677..1888089 (+ strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_140:1888152..1888174 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:1888234..1888268 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_140:1888311..1888480 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_140:1888537..1888977 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_140:1889009..1889201 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_140:1889252..1889560 (+ strand)
Length: 309
>GLEAN_2562 class=GenePrediction position=GCSC_140:1887677..1889560 (+ strand)
ATGGTGTCGATGGACGAAAAAGAGGCTTCTGAGACTGATGCTGTTACGATCACGATTGCCACAGCCTCTGTGGGTCTCCC
TCTGACCTGGAAGACTGTGATCTGGCCAAACAGAAAGACCAGCACCAGCACACGGACCGACGTCTGTCCACGGCGCTCTC
ACGCATCGCCAGCAACACCAGCTCCGCCATCCGCTTCCACCAGCTACATGAGCAAGAACAGTGCGGACGATCCAGCCCTG
CCGCTCAATTTTCCGTCCCACAAGAAGTGGCTGATCATCTTCCTGCTGGCCAGCATGACATTCATGACGCCTTTCGCCTC
GTCCATCCTCGCTCCGTCCATCGGCTTCATGGACAGCGAGTTTGGCAATGACAGCCTCACCATGGGGTCGCTCGCCGTGA
GCATTTATCTCTTGTGCGTCCAAGAGAATGCTCCGATCATCTGTCTGGATGCTGACAGGCTCGCACACCACACAGGGGCT
ATGCCGTCGGACCACTGTGTTTGTCTTCTCTCGGTCTCTAGCTGCCGGCTCTTCTGGCTGACCTTTGCCCTCTGCAGTTC
TCGCCGGGCAGTCCGAGATCTACGGCCGCCACGTCGTCCTCGTCAGCTCCAACATCTTCTTCTGCGTCTGACAGACCGGC
TGTGCCCTGGCCCCATCGCTTGGGGCTCTCATCGGCTTCCGCTTTCTCTCTGGAATCGGTGGCAGTGCCTGCTTGACTCT
GGGTGGCGGCTACGTTAGCGACCTGGTAAGATTGGATGTTGAAGAGAGAGGCCAGGCTCTATCGGTGTGGACGGTTGGCC
CGCTGTGAGAACGAGAAGCACACCCCCTCATCCGCTCTGCTCAGGCTGACTGTAGCACAGTATTGGTCCCACGATCGGTC
CCCTCGTCGGCGCCTGGCTTGGCCAGACGATAGGGTGGCGCTGGAGCTTCTGGATCGTGCTGATTCCCAGGACCCTCAAC
ACGATAGTGATTGCCATGTTCAGCTGCGAGACCAGCGACCGAATCATCATCCAGAACAAGCTCAGGCGGCTGTCCAAGCA
GCTCGGGCGGACGGATTTGCGCAGCTGCTACGAGGACCTTGATGCGGTGCCAGTGCCACGAAAGACGATCCTGGCACACG
GACTCATGCGGCCGCTGAAGATGCTTTGTCTGTCGCCGACCATTTTCATTCTGTCGCTGTACATTGCGTTTGCCTACGGC
GTGCTGTACCTGCTCTTCAACACCATTCCCAAGGTCTTCCAGGACGGCTATGGCTGGAGCATCGGCATCACCGGACTCGT
GTATATTCCGCTCGACCTCGGGTATGTGGTCCCTCTTCTGTGCAGGCGGCAGCGCTGACGGCAGAAGCTACGTCTTGGGC
CTCTTTGTGTTCGCCCACATGTCGGACCGCACAGTGCTGCGGCTGAACAGGAAGAACAACGGCGTGTTTGAGCCGGAGAT
GCGCCTTGTCGACTGCATCTACTTTGCCTGCTGTCTGCCCGTCACTTTTTTCTGGTACGGCTGGTCGGCCAGCTACCGTG
TTCATGTGAGCTGCTCTCCGTCCGTTTCTGCAGGCCTCCTTTCTGATGCAGACAGTGGATCGTGCCTGTTCTGGGCCTGT
TTCCGTACGGGTTTGCGATGCTGGGCATCTGGCAGCCGCTGCAGGCGTACATGATCGACTCGAATGGCTACTATGCGGCC
AGCGGGATGGCGGCCTTTACGGTGCTGCGGTCCGTTGTCGCGGCGTTTCTGCCGCTGGCCGGGCCCAGCATGTACGAGAC
GCTCGGTCTGGGCTGGGGCAATAGTCTACTGGGTTTTATCTGTGTGATTCTGATTCCGGTGCCTTTGTTGATGTATCGAC
ATGGCAAGGCACTGCGTCAGAAATTTCCACTGAAGCTTGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62