GenePrediction:GLEAN_2563 Details

Name: GLEAN_2563
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1899806..1900910 (+ strand)
Length: 1105
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1899806..1900374 (+ strand)
Length: 569
Type: CDS
Source: GLEAN
Position: GCSC_140:1900426..1900507 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_140:1900566..1900910 (+ strand)
Length: 345
>GLEAN_2563 class=GenePrediction position=GCSC_140:1899806..1900910 (+ strand)
ATGTCATCGCTTCTCGTGCGCCTTGGGCTATCGCGGGCTGGACCCTGGGAACCGCCCAGCGTGCTGGACCGACTGCTGGC
GTCGCCGGTGCGCGCAGTCGCCTATTTTCTGTGGCGAGCAATGACAGCAATGCAGAGTTGGATGAGAACGAGAACGAGAA
CAAGAAAGACAGAAACGAACTCGAGCTCGACATCAGCCCCCCTTCGTGTCGTCTGCATCGCCGACACGCACGACCTCTTT
CCGGCTCATGTGCCTCCCGGCGACCTGCTCATCCACGCCGGTGACCTCACCAACAGCGGCTCGCCGGCCGATCTGCAGCT
CATGCTCGACTGGCTCACCGCCCAGCCACATCGCCACAAGGTTGTCGTCGCCGGCAACCATGACGCTTGGATGGATCCGG
TCGCTCGTGTGGCTGCTGGGCTCACGTCGCCTTTGCCGCCCGATCCCGTCTTCGCCACCAACGTCCACTACCTCCAACAC
CGCTCTGTCGTCCTCGATTTTGCTGCCGGCCGCCGGCTCACCGTCTTTGGCGCCCCCGACATTCCCGTCTGCGGACCGGC
CTCGTTTGCGTATGCCATCCCTCTGAGCTCCCGTCGCTCCCACCATGCTCACTCTCACAGCTTCCAGTACGATCCGGACA
CCCCTCCCTGGAAGGATGCCATCCCCGCCGACATTGACATCCTCGTTACTCATGCCCCCCCTGTAAGGCTTTGTGTCCCG
GCCCCGTTGACTCCATCCACCTCTGATCTTTGACCTGCAGCGCCATCACTGCGATCTCGAGCTCGGCTGCCCCGGCCTCC
TCCGTGAGCTCTGGCGCGTCCGCCCTGCTCTGCACGTGTTTGGTCACGTGCACTGGGGAGCCGGCCGTGAAGTCCTTCAC
TGGGACGCCAGCCAGCAGGCCTACGAATCGCTCATGGGCGAGGCTTCGCCATCGTCGTGGCTGGCCTGTCTGCGCCTGCT
GCTTTCCGGCGTCCTGTCATCGGCTGCTGCTCTAGCCTGGCCGTCTATGACGATAGACTGCCCAACAACCGTGCTGATCA
ACGCTGCTCAGATGTATGGCGACACCGGCCGTCTGCGCAACGATGTGCAGGTCATTGATCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62