GenePrediction:GLEAN_2565 Details

Name: GLEAN_2565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1916909..1917598 (+ strand)
Length: 690
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1916909..1916964 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_140:1917214..1917598 (+ strand)
Length: 385
>GLEAN_2565 class=GenePrediction position=GCSC_140:1916909..1917598 (+ strand)
ATGGCCCCGGCGAAGCAGCGCTCGGGCGCCGACGACCACAAGGCAGACGCAGCAGCGTCCAAGGAGAAGAACGGGCACAG
CCACGCAAACGGGGGCGGATTCCACGCCCCGACAAATGGCAAGTCACGTCGAGCTGCCAACTCCAATACGGCGACGGCAG
CATCGACAGCGGCGGCAGCGGCAGCGGCAGCAGCGACAGCAGCAGCAGAGCAGCAGCAGCTGGCCAGTACCCTGAACGGG
CCTGCAGATGTCGGATTGAACGTGCCATCACCGCCTACTGTGAGTACTTGGCCCTCTCAAGACAGAGCAAGCAAGGGCAG
GGATGTGCGGCTGACGGGTGCGTCTCGCGAGCAGATCCAATGGATGGAGTTTGAACGGGACGTGCTGCACGCGTACGTCC
GCACGTACCAGATCGAGTCGCCCAGCGCATTTTCCAACGACCTGCACCGGTGGATGCTCTCACAGCCAGGAAGCATCGGG
CTGCAGTCGCCGACGATGCGACGCCACAAGGCGCTGCGGCGGCAGAGCAAGGCGCAGCTGGCCAGCACGACGCGGAAACA
CTCGAACAACCTGGGGGTGCAGGAGAACGACGTGATTGTCGACTTCCTACACAAGGTGCAGAACCACGAGGTTGTGCGGT
TGCGTCGGCTGAGGAGAAACGGGTCGAACTCGCGTGGACGTGAGGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62