GenePrediction:GLEAN_2566 Details

Name: GLEAN_2566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1918170..1919980 (+ strand)
Length: 1811
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1918170..1918412 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_140:1918478..1919980 (+ strand)
Length: 1503
>GLEAN_2566 class=GenePrediction position=GCSC_140:1918170..1919980 (+ strand)
ATGAACGCCAGCCTCTTCTCCAAGGCATCTATCTCAGCACGGCCGCTGGCGCCGATGTTGCAGCTGTGCCGGGGATCCAG
ACAGAAGCTGCGGCTCTCGTCGACGTCACAGTCTTCTGCGGCCGCATCAATATGCACAGGCCGACGAGCAGGCTATAGCT
CGGCAGCGTTTGGCAACGTGCGGTCGGGCTCGCGCACATGCGCAGTCTCGGGTGCACGGCCCCGGCCGACTGTAGCACGC
CGGGTAGGCTTTCACTTTGCACCTTTGTTCCCCTTTGTTCCCCTTTGTTCCCCTTCGTCTGCTGACAGCGTCTGCACAAG
AGTTTCCACGCGACAGGTCGATCGATGGCGGCGCCAAAGGACCCGTACAAGGTGCTCGGGGTAGAGAAGAGCGCAACGGC
GTCAGATGTCAAGAAGGCATACTACGGGCTGGCCAAGAAATTTCACCCAGACACGAACAAGGACCCGACGGCCAAGGAGC
GGTTTGCCGAGGTGCAGACGGCATACGAGATCCTATCGGACCCCAAGAAGCGCGAGCAGTACGACCAGTTCGGGGCAGCC
GGGGTTGACCCGAACGCGGCGGGCGGCATGGGCGGCGACCCATTTGGCGGCGGTGGCAACCCATTCGCAGGCTTCGGCGG
CGGCGGTGGTGGTGGGCAGGGCGGTTTCGGAGCCAACTTCAACTTTGAGGATCTGTTTCAGGCCTTCACGGGACAGGGCG
GAGCGGGCAACCCGTTTGGGCGGCGAGGTGGAGCAGCAGGCGGCGGTGGAGGTGGAGGCGGACGCAATCCGTTTCAGCAA
GAGATCCTAGTGGGCGACAACATCGAGATTCAGACGAGTATCAGCTTCCTGGAGGCGGCACGGGGGGTGACCAAGTCGAT
CAAGACGACGCCGCTGCTGCCGTGCAAGCCGTGTGGTGGCAGCGGGCTAAAGCCGGGGACGAAGCGCAGCGGCTGCACTT
CGTGCAACGGCACGGGCACGCGGGTGCACTTTGTGCAGGGCGGCTTCCAGATGGCATCGACGTGCGGTGCCTGTGGCGGT
TCGGGATCAACGATTTCGCGGGGGTCGGCGTGCCGAACGTGTGGCGGCGATGGTGCGGTGCGAGAGCGCCAGACGATTGC
AGTCGACATTCCAGGCGGCGTGGAAGACGGTATGCGGCTGCGGGTGGACGGCCAGGGTGATGCAGCACTGACAGGACGGA
CAGCTGGGCCCAGTGGCAGCGAGGCAGCACGCGGTGTGCGCGGCGACCTGTATGTGTTTGTGCACGTGGCCGCCGATCCC
AAGTTCAGCCGGTCCGGAGCCGACATTCTGCACATGGCCACGGTGCCGCTGACGACGGCCGTTCTTGGCGGCGAGGTCAC
GGTGCCGACGCTCGACGGCGAGGTCAAAGTGCGTGTGGCCACGGGCACCAGCACCGGTGATCGCATCACGCTCAGCGGCA
TGGGCATGAAGAAGCTTGGCAGCCGGCGACCTGCATCGGGTGATCTGCGTGTTGAGTTCCGTGTCGCCATGCCCAAGCAT
CTCACCGCCAACCAGCGTACCATTCTCGAGATGCTCGCCGACGAGATGGATGACAAGACGGCCAAGCGCGTCATGAATCT
GCATCGCTCTGGCCCGACCGGTTCCGAGAACCCAGACGGCTCCCACGAGAACGAGAGCTTCCTCCGGTCCATCTGGCATA
ACCTGACCAACCATCCGGCTCACGGGACCAGCAGCAGCACGGACAGTACCGGCAGTTCTGGCTCTGGCCCCAAGACTGAC
GACTCCAAGGCCCAGGACCAGAAAAAGACATCTGGCCCCGATTCGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62