GenePrediction:GLEAN_2567 Details

Name: GLEAN_2567
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1925560..1927822 (+ strand)
Length: 2263
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1925560..1925933 (+ strand)
Length: 374
Type: CDS
Source: GLEAN
Position: GCSC_140:1926010..1926141 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_140:1926192..1926679 (+ strand)
Length: 488
Type: CDS
Source: GLEAN
Position: GCSC_140:1926741..1927822 (+ strand)
Length: 1082
>GLEAN_2567 class=GenePrediction position=GCSC_140:1925560..1927822 (+ strand)
ATGGGAGCCAAAGGCCCCTCTCCATCTGATGTCTCCCTTACTACCGATGTCAAACGCCCAGAGCCCGACCAGACACTCCG
TGAGCCTGCGGATGCGGAAAAGCTAGCACCAGTAGCAACAGAGCAGAATGGTCCGCCGCCAAACGACCTCTTCCAGCCCA
AGAGCATCAAGTTCTGGATGATCCTGCTGTGCAACTTTCTTGCCCTCTTCCTCGTGGCTCTTGATCGCACCATTGTCGCC
ACAGCTGTGCCTCAGATCTCAGATGACTTCAACAGCCTTGGAGACATAGGCTGGTTTGCCTCGGCCTACATGTTGACAAC
ATCGGCATCTCAGCTTCTCTTTGGGCGCATCTACCGGTTTTACCCAATGAAATGGTGAGTTTGAGACATGTTCCTTTTAT
CGGCAACTTCTTCGGACTCCCCCACCTCTTGCCGATACTCACACCGACAGGACATTTCTCACCTGCGTCGTCGTATTCGA
GATTGGGTCCGCAATATGCGGTGCTGCGCCCGGCTCGACTGTCTTTATTGTGGGACGCGCTATCGCCGGCGTCGCGTCGG
CGGGCATCTTCTCGGGCTGCATGTTAATCATGATCCCCATGATTCCCCTACACAAACGACCGATGTTCCCAGGGGCCTCT
TCGGTATGGTGTTTGGCATCGCCTCCGTCGTGGGCCCGCTTGTTGGAGGCGCCTTTACCAGTTCCGTCACCTGGAGATGG
TGCTTTTACATCAACCTTCCTATCGGCGGCTTCACGCTGCTATTCATGTGCTTTTTCTGGAACCCGCCGGCACAAACGTA
TCTCCCGGCACCGCTCTGGACCCACGTCAAGCGGCTTGACCCTCTCGGCACGCTGTTCTTTTTGCCCGGCATAGTCTGCC
TGCTGTTGGCCCTGCAGTGGGGCGGCTCCAAATACGCATGGAGCAGCTGGCGTGTCATCCCGCTGTTCCTGCTCTTCGGT
GCGCTCATGCTGGCCTTTACTGTCGTGCAGATCATGCTTCCTGAAACAGCCACGCTGCCTGGACGTGTCATCACACAGCG
AAGCGTGCTCGCGGGTGCTTCTTTCACCTTCTTTCTGTCGGCCTCCATGCTGACGTTGGTGTACTTCATCCCGCTATGGT
GTAAGTGAATATGGCGCTTGGACGAGCTTCTCATTCTCACCTGCTGACCAGCCAAAAACAGTCCAGACAACCAAGAACGC
AACAGCACTCGAGTCTGGAATCGATACCATTCCGCTAGTATTGAGCCTCGTCGTGTCAAGCATCATGTCTGGCATCGCCA
CACAGAAAATCGGCTACTATGTTCCATCGATGCTGCTGGCACCCTGTATCATGTCCGTTGGCCAGGGGCTCATGAGCACG
TTCACGCCCTCGACCCGCTCGTCTCACTGGATCGCCTTTGAGTTTATCTCTGGCTTCGGCCTCGGTCTCGGTATGCAGAT
TGGAAACCTGGCCGCCCAGACCGTTTTACCGCCTGCAGATATACCGACCGGCGTGGCTATCATGTTCTTCGTGCAGCAGC
TGGGCGGTTCCATCTTCACCTCTGTTGGAGAGACCATCCTGAGCAACCTCTTGGTATCGAAGCTTGGAGGCATCCCGGGT
CTCGATATGGCCTCAATCGTCAACGGTGGCGCCACCGAAATAGCCAAGGTGGTGCCAGCGGAGTACCTCCCCGCTGTTGT
TGAAGCATACAACTATGCGACCACGCGAATCTTCCTGATGGGCATGGGCCTCGCCTTCTGTGCACTCATCTCAGGCTTCT
TCATGGAGTGGCGCAGCATCAAGAAGCCTCCTGGTTCTCTGGGCGGTCCTCCCACCGGTCCTTCTAAAAATCCTGCGGAG
AAAAGCTCTGGAGTGCTCAAATCGCTACAAATTCCAAGTGCACCAGACCTTCCGGCTAAGCTAAGACGACTTCAGCCCGA
AACATCAGACACGAAACTCATCGCTCCACCCCCTGCGTACTCCAGGTCAGACTTGTCGGTAGTGGCTAGGTCGTCCATAT
TATCCCAGGCGACGGCAGTGGGCAGTGACTGCCCAACACCCACCAAAACTTTGAGGGACTCATCCTACTCACCTTCAGTG
GTCGGAGGAGGCCCTCCGGTCAGTCTTCAGATTATCAGGGTACGACTGCAAGAGGAGGAAAAGTTGCGACAGGCGAGAAG
AGAATCGGAGCCTGGCTTCGAGAGCCCTCGGCGAAACTCGGCACGACTGTCCAGGACCCTCAGGAGAAGCAGCTCGTCGA
CAGAACGATATACATTCGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62