GenePrediction:GLEAN_2568 Details

Name: GLEAN_2568
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1931845..1935241 (+ strand)
Length: 3397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1931845..1931943 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_140:1932027..1932361 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_140:1932420..1932529 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_140:1932692..1934691 (+ strand)
Length: 2000
Type: CDS
Source: GLEAN
Position: GCSC_140:1934747..1935241 (+ strand)
Length: 495
>GLEAN_2568 class=GenePrediction position=GCSC_140:1931845..1935241 (+ strand)
ATGGCCGCAGCCAGACCTGTACAGGAGCAGAGCTCCCAGGCCCGACGCCTCACCATCCTCGATCTTCCCGAGGAGACTCA
CAGGGAGATCTTCAACCACGTGTGTGACCTTTGCGGCCTCTTGCCTTTGTCTACGTCCCTTGCCATCATCATCGAGGCTT
CTTTGAGCTCACATTTTTCCAGTGCAACATGTCCGAGCTCGTCTGTCTGGCCCTTGTGTCCAAGCACTTTCATCACATCG
CTTCCGAGATTATGTACCGCACCCTCCATTTCTCTCTCCCATACCATGGCGGTAAGCTGTGCGAAGACACCCTGGCTGCT
TGCCTCAACACCCTCACCACCAGCGAGTACAACTACGCACGTCACCTCCGAGAGCTCTTCATCGATGCTTCCTATGGAAC
CGGCCCCGAAGCCGACAGGACCATCGCACCATACGTCTATTCTGAGAGCTGTGGAAAATTCCTGAATACCCTTCTTCTCT
TAACCCTCCGCAAGACCAAGGGTCTGGAGAAGTTCTAGTGAGCTGTCTTCCATCTATCACCCCTCTCCGAGTACCTACAG
TCTGACACATAGCAGCTGGGATGTCCGGATAGAACTGGGCCGACCGGTTTTCAGAGTGCTGCACCAGATCCACACACTCT
CCGACGTCCAGATCCGCCTCCAAAAGGGCCCGTCGATACACGAGAGTACGCCATTGCTTCCGCTAAGCCATTCTTCCTCC
TTGTCAACATTTGTGCCACACTCCACGTCGACCGGCATGCCAATAGAGTCTATCATCCATCTGCCCTCATTTCAACACAT
GCCGTTTCAGCCACCTCATCCCAACACCTTTGTGCCTATCACGACAGCTTCGGCATTCTACAATCCCTTTACGCCTGCAC
CCTCTCCAATTTCTGCTCAGCTGAAGACACAGTCTCGTCCCAGCAAAGTGCCGAAGCGAGGACTCTCACGGGCCGAGCCG
CCCACCATATCTGGTTTCAAGAATCTCAAAGTTCTCTCTGTTCTCGACATCGACGCCCTCGACGTCATCACCGAGATCAA
ACCTTGCTTGCGAAACTCGGCCGGGACTATCATTGAGCTCAGTCTATCTTTTTCTGAAGCTCTGGCTTCCAAGGCACGCA
AGCCGCCGCCCGATACCGACTCGGAAGAATCAGACTTCGATGACATTGAATTTAACGTTCCCCTAAGTACTACACTGGCC
GATGCTGAACCTGCTACCACGAACCAGGCGCATGCATCATCGAAGCTCCTGTATGCGCAGGAGGAAAAGTATAGGCAGGA
TTCTGCCTTGAGCAGGATATTCGACCTGGAGCCGTTCCTCCTTCGACAGCAGCCAAAGCAGCCGAAAGTCAGCGCGAATG
GCAGTGCATCTAATGCAAGCTTGGCTTCCGACTCAAATAACAGCAGGGTTGAGTTTGCGAACGCTGTCCGCGATATGACA
GTGCAGCTTTTAAATAGCACCGTCAGTGGAAGCAACATTGGGGATCATTCAAAGATGCTGGATACAATCGAATCTGCCGC
CAAGAAATACATAGATTCGGAAGATGCTAAGAGCGCCCAAGAAAAGAAGGGTGATCAAGTCAAGGAGCACGGCCAGAGCA
AGAAAGGAAACGCTCTGAACACCACCGACACGATCGTCTCAGAGTCCGGCCTTGACGGCTCTGCAGCAGATGAGAGCGAC
AAGGAAGTAAGCCTTTTCAGAGACGGAGACACGGTCACCAAGCTCAAAAGTAAGGGTGCAGACGTCAGCCCGGAGGACAT
TGACGTCGAGGAACCGGAGGGCCAACTTGTTCTCGAGGAAGGTTCATGCGACAGGGATCTGGAAGACTCAAGCGACAAGG
AAGCCGATCCAGAGCTGCCGACCGATTCTGTATTAGCATCTGCATCTGCTTCCGGACAGGCTCAAAGTAGCCCACAAGGC
CAATCTAGCACTTGGGGTGGCCAGCAAGATCCTTTGGCGGAACCAATAAGCGATGACAGCATAAACAAATTGGCGGCCGA
TATCTCTGCCCAGAAAGCTAACTTAAAAGCCTTGCTGGACAGACTGGCAACATTGGAGAAACGGGCACTTACTTCACGGA
AAGGGCTCGAGGCCATGTACAGTATGCGAGACGATGTTGAGCCGCAAGTTCTGCTGGAAATGGAGAGGCGAGAACAAGCC
TTGCACAAAGACATTCAGCGTCTCTTCCAAGAGACACGAACAGTTGCGGCCGAAGTGCGGGACATTGAGGCTAGCAAGCC
TGCATCAAAGACAGGTCGTGAGACGCCTCAGGAGGCTTCTGCTGCCGAGACTCCTGATGCTGCCAACTCAGCGCAAGCAC
ACAGTAATCGTCGACTCGTCGACAAGTATGTGCGGTCCACGCGCGGTATAGTGTTGGAGGAACTCAATCTAAGCCTCATT
CCTGTCACGGCATCGGTGTTGTCCAAGGCCATTGATCTGCACACGCTGGTGCGCATTACCCTGCTCAACGTCGGACCACA
GGCGCCTATCTGGTCGCTCTTCTCCAGAGAGAACAGGTCGCGGCCGCTGGCGCTGCGATCGATCTTTACCGACAATGTGT
CAACGGTCTTTCTGGTTTTTGTCGCACAGCTCGAAGAGGTGCATACGTTGCTCTTGCTGGAGCGAGATGCAAACCACAAG
CCCGAGAGCCTGGCGCCCAAGACAACGACCACGATCAGCGATATCCGGCACATTGTTCTGAAGAAACACGCCCGTCACCT
GAAGAAGCTCATGATCAAGAATGCCGCCAGCCAAGACTGGGATGTGGACGAGGCGACGATAAAGCTCCTGGGCCGACGTG
CACGGAATCTCGCAGAGCTGGCTGTCAGCATGAAAATGCAAACGATTGTAAGGCCTCTCTCTACGTCCTGAGTGTTTACT
TTAGCTGACTTGGCTGTCATAGCACGATCTCATACTACAGCTGCCCAACTTTATGGGGCTTGTGGCTCTCAATATCATCC
GGTTACGGAATGATGATACGTGCGTGTGGGTGACACAGGAGATCAAACGGTTCATACTCGACACCGTTGCGCACTACCCG
CATCTCATACTGGAGTGGCTGGCCATCGACAACAACTTGTCTGTAGAGCGCATCATGCGTGTCAGCCCGAAGAAGATGGT
CGAGGCCAAAAAACAGAAGAAGATGAAGAAAGCAGGACAGTCCAAGGGCAAAGAGAAGGCGACGAACACCCAATGGTCCG
GCTCTTTCGAGACCAATGGGTTCTCAAAGGGCAGCGCAGCAAGCAAGATCTACGACAACAGCGACGATAGCGACAGCAGC
AGCAGCGATGGCAGCGCCCCGTACAAACAAGCCAAGCTTCAGCTGGAACACTGCCATGTCGATGACACCTGGGACATTTC
GATATTTGACAGGGTGGTCAGAGTCGGCCGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62