GenePrediction:GLEAN_2569 Details

Name: GLEAN_2569
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1938666..1940875 (+ strand)
Length: 2210
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1938666..1939521 (+ strand)
Length: 856
Type: CDS
Source: GLEAN
Position: GCSC_140:1939579..1940714 (+ strand)
Length: 1136
Type: CDS
Source: GLEAN
Position: GCSC_140:1940777..1940875 (+ strand)
Length: 99
>GLEAN_2569 class=GenePrediction position=GCSC_140:1938666..1940875 (+ strand)
ATGACCATCCAGATATTGGAGCCGCGCATCACGGCCCGGCCGCCGTATACCGTCGAGGTTCCCGGCCAAAAAGACATCCC
TGGCGAGACGAAGGTCCGCCGGCATCCGCAGTCCGTCCCTGAGCTCATTAGCAAACCAGCCGAGAACATCTCGACTCTGT
TTGAGCTCGTCACGGTCTCGGTTGAGAAGTATGGCAACGCCAACATCATGGGCTCGCGCCGCCTGCTGCGCACCCATCAG
GAGACGAAGAAGGTCAAGAAGATGATCGACGGCGAGGAGCGCGAGGTCGACAAACAGTGGACCTACTTCGAGTTGAGTGC
CTACGAATACATCACTTACAACGAGTACCTGCGTCGCATCCTGCAGATTGGAGCTGGCCTCCGCAAGCTCGGCTTGGCAT
CTGGCGATCGCGTTCACGTCTTCGCCGCCACCAGCGCGAACTGGCTCTCTATCGCCCACGGCGCTTGCACCCAGTCCATC
TCCATCGTTACCGCCTACGACACCCTTGGCCAGGAAGGTCTCCGTCATTCCATGGTCGCCACCCGTGCAAAGGCCGTCTT
CCTCGACCCCCATCTTCTGCCCACCCTCGGCAACGTGCTTGCCGATGCTTCCGAGATCCGCCACGTTATCTGGAATGACC
AGCACCAGGTCAAGCAGGAACATATTGACAAGCTTGTCAAGGCGTTCCCCCACATCACCGTCCTCAGTCACAGCGATCTC
ATCAAGCTCGGCGATGAGAGCCCCGTCGACCCTGTGCCGCCAAACGCTGATGACCTCTGCTGCATCATGTACACATCGGG
CTCGACCGGCACCCCGAAGGGCGTTCCGCTGACGCACAAGGCTGTCGTCGCTGCAGGTTTGTGCCTTTTAAATCCTGCTA
CAATGCTCTACCCTTTGCTAACAGAACCCACAGTCGCCGGTGTTAGCGTCGTTGTGCAGGCATACGTTGGCCCGGGCGAC
GGCCTGCTAACTTATCTTCCGCTGGCGCACATCCTCGAGTTCGTCTTCGAGAATGCGTCCATCTTCTGGGGCTCGACAAT
GGGCTATGGCAACCCCAAAACTCTGTCCGACACATCAGTGCGCAACTGCAGTGGTGACATCAAGGAGTTCCGACCAACCG
TCCTCGTCGGCGTCCCGGCCGTGTGGGAAATGGTCAAGAAGGGCATTGTCTCCAAGGTCAGCGCTGGCAGCCCGATAGTA
CGCTCTCTTTTCTGGGGCGCCATGTGGGCGAAGACCAACCTCATGCACCTGGGCCTGCCCGGCTCCGGCGTCTTGGATGC
TGTTGTCTTCAAGAAGATCAAGGAGGCGACAGGTGGCCGCATGAAGCTTTGCCTGAACGGCGGTGGTCCGGTGGCCAAGG
ACACGCAGCGCTTTATTTCCATGTCTATCTGCCCAATGATCAGTGGCTACGGTCTGACCGAGACCACCGCCATGGGCGTG
CTGCAGAACCCTGCTGAGTGGACTACCGATGCTCTGGGCGCCATGCCAGCGTCTGTAGAGGCCAAGCTGGTAGATTTCGC
CGATGCTGGCTATCACGCCACCAACAAGCCGAACCCCCAGGGCGAGGTGTGGCTGCGCGGACCCAGTGTCACGAGCGGCT
ACTACGAAAACCAGGAGCTGACCGAGGAGGCTATCACTCCTGACGGCTGGTTCAAGACGGGCGACATTGGCGAGTTTCTA
CCCAACGGCCACCTGAAGCTGATCGACCGCAAGAAGAACCTGATCAAGACGCTGAACGGCGAATACATTGCACTCGAGAA
GCTGGAATCGGTCTACCGGTCGGCCCAGGTTGTGGCAAACATCTGCTGCTATGCCGACGATTCGAAGGCGAAGCCCATTG
CTATTATTGTGCCTGCCGAGCCGGCGCTGAAGAAGCTGGCCGAGACAATTGGTGTGCAGGGACAGAACGTTGAGGAGCTC
GTGCACAGCAAGAAGCTGCAGACGGCAGTTCTGAAGGAGATGCAGGCAGCTGGCCGGCAGGGAGGGCTTTCGGGCATAGA
GATCATCGATGGCGTTGTCCTGTCGGATGAGGAGTGGACCCCACAGAACGTAAGTGACAGAAAGATATACCAACTGATGA
GCCGGACAGTCTGCTAACGGGTATTCTACAGGGTTTGGTGACGGCAGCACAGAAGCTGAACCGGCGCGACATTTTGAAGA
AGTACCGCACGGAAGTGGACAGTGCTTATGCTATGGCAGCTTCTAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62