GenePrediction:GLEAN_256 Details

Name: GLEAN_256
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:580034..582299 (+ strand)
Length: 2266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:580034..580225 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_167:580302..581516 (+ strand)
Length: 1215
Type: CDS
Source: GLEAN
Position: GCSC_167:581589..582299 (+ strand)
Length: 711
>GLEAN_256 class=GenePrediction position=GCSC_167:580034..582299 (+ strand)
ATGTCGCTCGCAACGTCCACGGTCAAGGAGGCCATCACGGAGGGCCTGATTGGTCATGAGAAATCTTCGCAGCTGTCGGC
GCAAACACGAATTCGCTTCCTCAAGCATGCCGTCAAGGATGCCGAGACCGGAGAGCTGTTCATGAAACTCGACCAGTTTC
TCGATGCTGTCGCGCCCGAGGGCTCGGACTTTGTAAGTTGCAGCATCCCCCGTTCTCAGTGGACTGTTTCGGAGTGTCCT
CTTCTCGCTTCTAACACCCCGCCCAAAGCACAAAATCCAGCGGGAGCAGTACACGATTCTCTTTCCCGTGGTGGACCGCC
AACGTCGCGGCCGCGTGTCCCTGGCCGACTGGGCGTACTTTGAGAACATCCTGGCCAAGCCTGACGCCGAGTACGAGATC
GCATTCCGGCTGTTCGACGCCGAGGGCCTCGGCACCGTCCGCTATGACGACTTCCGGCGGCTGTACGAGCTTAACAAGGG
CACCGACAGCATCCCGTTCAACTGGGACTGCGAGTGGACCCGGCTGTACATTGGCGACAAGCGCAAGCGTCACGACCTGG
ACTACGCCCAGTTCTCGCAGATGCTGCGCGGCCTGCAGGGCGAGCGCATACGCCAGGCCTTCCAGCTACTCGATCGTGAC
GGCGACGGCTACATTGAGCCGCAGGAATTTGAGCGCATCATCGTCGAGACGGCGCGCCACAAGCTGTCAGACCATCTGCT
GGCGCACCTGCACACGCTCTGCAACATCTCCCAGGGCAGCAAGGTCTCGTATGCCAATGTACGGGCGTTCCAGAACGTGG
TGACCGAGATGGACCTCGTCGAGCTCATCGTCCACCGCGCCTGTGCCAAGGCTACCGACGGCAAGATCACGCGCACCGAC
TTCCTCAACCAGGCTGCCCGCACTGCGCGCTTCTCTCTCTTCACGCCCATGGAGGCCGACATCCTCTTTCACTTTGCCAG
TATTGACGAGCCGTCGGGCCGGCTGGGCTTGGCTGACTTTGCCAAGGTGCTCGACCCATCATGGCGCAGCCAGGAGGCAC
ATCTGTCCTCGGCCGCAGCTGCTGCTGCTGCGGTCGGCACGGGCGCCGGACAGCCCAAGGCGCGATCGGCTGCCCGGTCA
TTCCTGTCGGACGCGCTCGAGTCGGCGTACAACTTCGGGCTAGGCAGCATAGCTGGCGCGTTTGGCGCGCTGATGGTGTA
CCCGATCGATCTGGTCAAGACGCGCATGCAGAACCAGCGTGATGCACGGCCGGGCGAGCGCCTGTACAACAACTCGATTG
ACTGTTTCCGCAAGGTGGTGCGCAACGAGGGCTTCCTGGGCCTGTACTCGGGCGTGCTGCCGCAGCTCGTGGGTGTGGCG
CCGGAGAAGGCCATCAAGCTGACGGTCAACGATCTGGTGCGCGGCTGGTTCACGCGCAAGGATGGCAGCATCTGGGTGGG
ACACGAAATGCTGGCGGGTGGTAGTGCTGGTGCCTGTCAAGTGGTGAGTTTCAAATATTTGTTCTTCTGATCTTTTGATA
TTCTGACTTGTTTCCTCTCATACTAATCCACCTAGGTCTTTACGAACCCGCTGGAGATTGTTAAGATCCGCCTGCAGGTG
CAGGGCGAGGTGGCCAAGAGCGTCGAGGGTGCACCCAGACGGTCGGCCATGTGGATCATCCGCAACTTGGGCCTGGTGGG
CCTGTACAAGGGTGCGTCGGCGTGTCTGCTGCGTGACGTGCCGTTCTCGTGCATCTACTTCCCGACGTACAGTCACCTGA
AGAAGGACTTGTTCGGCGAGTCCAGGACGAAGAAGCTGGACGTGTGGCAGCTGCTGACGTCCGGCGCCATTGCTGGCATG
CCGGCTGCATACCTGACAACGCCGTGCGACGTGATCAAGACCCGGCTACAGGTGGAGGCCCGCAAGGGCGACACGCAGTA
CACGGGTCTGCGCCACGCTGCCAGCACCATCTGGAAGGAGGAGGGTTTCAAGGCCTTCTTCAAGGGCGGACCGGCACGCA
TCCTGCGGTCGTCGCCGCAGTTCGGCTTCACGCTGGCGGCGTACGAGGTGCTGCAGACCCATCTCCCGTATCCGGGCCAG
AGCAACAAGAAGAACAAGGAGCTGCTTCTGTCGGGTGCTGGCGCAGTCGATGCGTCCAGTCCGGTGATTCGCAGCCGCAA
TGCGCTCCGGATCATCCTGGACCTGGACGAGAACTTTGGAAAGCTGCGACTGCCGGATCAGAAGGGCTGGCAGTCACTGC
CCAACAGCCTGAGCGGCCGGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62