GenePrediction:GLEAN_2570 Details

Name: GLEAN_2570
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1950067..1951684 (+ strand)
Length: 1618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1950067..1950177 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:1950254..1950401 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_140:1950462..1951684 (+ strand)
Length: 1223
>GLEAN_2570 class=GenePrediction position=GCSC_140:1950067..1951684 (+ strand)
ATGAGGAACACGCACATCTTCGCGGGCACAAGCTGCCCCGCACTCACGAACCAGATCTGTGGGAATCTGGGCATGGCAAA
GGGCGAGGCCGAACTCACCCAGTTCTCCAATGTCAGTTCTGCTGTCTTGAGACACCGCGGCTAGCGTCAGAGGGACTTGG
ACGCTGATACTCGTGTTCATCTTCCAGGGCGAAACCAGTGTGCGCATCCTGACGAGCGTCAGAGAGAAGGATGTCTTTAT
CGTCCAGTCCGGCAGTCCCAGGACGAACGACACGCTGATGGAACTGCTTATCATGGTCTCTGCTTGCAAGGGAGGCTCAG
CAAGCAAGGTCACAGGTTAGTCGAGCTGGTGCGCTTCTACTCGCCGTTCCCGCGCTGACAGTAGCCTGATCACAGCCGTG
ATGCCCTACTTCCCCTACTCTCGTCAGTCGAAGAAGAAGTCACATCGGGGTGCAGTGACAGCACGGATGATTGCCAACTT
GTTGGATGTAGCTGGTGTCAAGCACGTCATTACCGTTGACCTGCATGCCTCCCAGATGCAGGGATTCTTCCAGTGCACTG
TGGACAACCTGCATGCCGAGCCGCTGATCGCGCGCTGGATCCGGCACAACATTCCCGAGTGGAAAGAATCGGTTGTGGTG
TCGAAGAACGCGGGTGGCACAAAACGGGTGACCTCACTGGCGGACGCGTTGAAGCTGAACTTTGGCATGGTGACGACGGA
CAAGCGGAGGTGGAACAACATGACGGCGAGCATGATCCTTCACCAGTCGGAGGGCGGCCCGCACACACCGGCAGCCATTG
CGAACTTCCGGGCGCTCCCCAGCCACACGCGGGTGCTTTCGGCGGGCTTGAACGGAATTACCCACTCGTCGGAGGCTTCG
AGCTCGAGAGGACCGGCGCCAACCAGCGCTCCTCGGAGCGATGCAGCGTCGGTGGCATCGACCAGCGAGTCCACGAAAAC
CGAGGGTCCATTCGAGGAGCAAGACGGCAAGTTGCAGAGTCAAGAGAATGCGGAGTACAACGATAGGCGTGCGCGTGAAG
TCACGCACGCACGCTTCATCCAAGGCCGCATTGTGCCGGACGACTTCCCATCACCAGCTCTCTCGGCCACGGGGAGCGTG
GCTGAAGACGACCCGATGACGATGTCTCACGTGTCGTCGTTCTTCCAGCCGGAGTCGCACGCTCTCGGCGGCTCGGGCGA
CGAAGGCGAGTCCAGCTCGGACGAGGAGGCGGAGGCGAGCACACACCCGCCTATCGAGCGCATGGTGACGCTGGTGGGCG
ACGTGCGCGACCGGACGGTGCTCATCGTCGACGACATGATCGACAAGCCGACGTCCTGGATTGCTGCGGCCGAAACGGTG
GTTAAGAAAGGCGGCGCACGGAAGGTGTACTGCATCGCCACGCACGGCGTCTTTGGCGGGGACTGTCTTAAGCAGTTGCA
GGCTTGCGAGTGCATCACCGGAATCATCGTCACCAACAGCTATCCGATCCGCGAGAATTATGGACACAGCACGAGCAAGC
TGGTCGTCCTCGACCTCTCTTTTCTTCTGGCTGAGGCCATCCGGCGCAACCATTATGGCGAGTCGATGTCTCCCCTGTTT
CAGCACGTTGCAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62