GenePrediction:GLEAN_2574 Details

Name: GLEAN_2574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1967337..1968640 (+ strand)
Length: 1304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1967337..1967443 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:1967522..1967558 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_140:1967621..1968390 (+ strand)
Length: 770
Type: CDS
Source: GLEAN
Position: GCSC_140:1968454..1968640 (+ strand)
Length: 187
>GLEAN_2574 class=GenePrediction position=GCSC_140:1967337..1968640 (+ strand)
ATGGACCGGCACGATCCATATTCTGTTGTGGATGAGCTGCTGCCGCACAGTGAGTCTACTGAAGGGTCGAATGCAAATCC
CCGGAAGAGGAAGAAGAGCTCGCGAGCGTGAGTCCTGTCATTCTGCCTCCGACGTCCCCGTCTGGAACCGAACCGGTTGC
TCATTCGTTCCTGACCGCCTGCTAGATGCGACTTTTGCCACACCAACCACCAGCCGTGCGACGTGAGTATGAAGCCATTC
TGTTCTGTCCAGGGCCGGCTCGCCGGGGCTGACTGTGATGCCAGAATGCAAAGCCAAGATGCAGCTACTGTCTGCGGCAT
GGCAAGTCCTGTCTCTACCTGCGCCCGCAGAAGAAGCGAGGCCCGGCACAGGGCTACCGGAGCGCGCTCCACACCATGCG
TGAGAGTGCAGCCGCATGGGGCGCTGCCCTGACCCTGATCCCCAGCCTGGGTCCCGTTGTCGAGGGCTACCTGAAGCAGC
CCGAGGGCAAGCGTCTCGTCCGAGCCATCCGGGACCCCCAGCAGCAGGAGTTCTTCATCCAAGCCTGGCAGCAGAGCACC
GTCTTCAAGACCTTTTTCGGCGACGAAGCCGGCTCCGAGGCCGGTGATGATGCCAGCCTCTGCAACACAGCCGCTGTCGG
CGCCGACGAAAATGCTGCTGTTAACGGCCTTGGCACAATCCCTCTGGCACGGCCCAAATTTACGGCAGAAAAGATTATAG
TGGCCGGACACGGACAGAGACCGAGATCAGCATCAGCAGGGTTGCCCGTAAAATCAGATGCCGCTGCCGGAGAGCTATAT
CCACAACCTGCTTCAGTGTATTCGGAGCTGGCGTCAGAAGCCTTCTCCGTGCACGAGCAGAGTATATTAGAACTCGAACC
GGAGCCTATTCTCACTCATCGGGCGCAGCAGCAACAGCAGCAACAGAGCGTTACACAGGCGCCGTTGCCTTTGCATGACG
ATGACGACAGGCAGTTGTCCAACAGCAGCTTTTCCGAGTTTGGGCTGGGTCCCATGTCCTTCTCAGACATTGTCGCCCGT
GATGCGGCACGGTCGTGCGTACCTTCTCCTATGCTGTGTGTCTCTATGCGCGATCATGGCAGCTAACTCGGCCACAGATC
GAACAGCTTCTCCCAGACGTTGGGCTCGCTGGGATTTGCGCCAGACGAGACGTTCAACGACTTCTTGGCTATTAGTTATA
ACCCGGACCCAGTGGCCGAACCCGCCGACGCTGATCCGCTGCTCGGCAGTGAGATGGACCAGAAGACCTATTATGAGCTA
CTCATGGGCAGGCAGTTTACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62