GenePrediction:GLEAN_2577 Details

Name: GLEAN_2577
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1975895..1978179 (+ strand)
Length: 2285
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1975895..1976118 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_140:1976169..1976274 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:1976775..1977059 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_140:1977157..1978179 (+ strand)
Length: 1023
>GLEAN_2577 class=GenePrediction position=GCSC_140:1975895..1978179 (+ strand)
ATGTCCCAGTTGTCGCTGGCAGCTCTCCCCGATCCCAACCTCAATCTTGCCCCGCTACGAATGATGGTGGACGACGGTGT
CCACGGACTATCGGCGCCGGCGCCACTGGAGCCCATCTCCCGGCCGAGCTCGGCCTCGACACAGGCATCGCTCGCCCAGC
TGCCGGGCATCTCCTCTCTCGCCATGGGCGCCGGCATGTCTGGCCGGAGCTCTCCACAGCCAAAGTAAGACACCCATCGC
CACATGATCACAGGAGCTCTGACACCCTTCACAGACCATCGACAATGGCAATGTCCACGGCTCTGGCAGGACTATCGGCC
CTGCATTCCAGCACGTCGTCGCCGGCCGCCACATCTACCGGCGGTTCGGCTGGCAATCTGGTGAGTTTTAGAAAGAAATG
GGGAACCTCGAAAGCGCGCATGCAACTGGCACCGGCTCCCGTCTCCTGTGCCTGTCTCTCCCTCTCGTCTTGTTGTGACC
GGGCAATCGGCGCGATGCGAATTAGCCCTGCTAGCGTCCGGTGGTCAGCTTCGTGTACCGCTCCATGCTCCTACGAGTTG
CTCAGTACGGCGTAGTTGGGCGACGATCCGTGCTTACTGCAGCCAATCCTGATACAGCAAAAGCGAGCAATCAGAAGGCG
CCGTCCTAATTCCACCCCTCCCATCCTTCCTTATCAATTCTTATGTACACAGTCCCACATTTCCCATCCCCCCGAATTAA
AACTGTCCAAACCACAGCAAATGTGTAATCTCATATCGGCACAACGATAAAGGTTTTTTTTGACCTCCTTATCATCTGGC
CGACATCAACTCCACCGCCCCCCCTTCTTATCCTTCGCATTCTCCATTGAGATTCACAAATTCCTATCACCCTCCGACAG
ATTGCACAATCAGGCTCCCCCAGAGACGACCCGGGACCGCTCAGGAAGATGGCAACCATGGCTAACCATGATCGCGAAAC
CACGCAGCCAATATGTCAAAACTGCGCGACTTCGACCACACCGTTATGGCGGCGCGACGAGATGGGCTCCGTGCTGTGCA
ATGCCTGCGGACTCTTTCTCAAGCTGCACGGCCGCCCGCGTCCCATCTCCCTGAAGACCGACGTGATCAAGAGCCGCAAC
CGAGTGAAGACGTCGATGCGACCTGACCTGGCCATGAAGAAGAAGGTTCGCGAACCCCCTTTCGTCTTTGCGTTTCGGTG
TCCTTATCTTCCTCTTATCCTCTTATCTGAGCCAGCCTGCTAACACGACCGTCGGTCCGCAGAACGCAGCCGCCGTCGCT
GCCGCTGCTGCCGGCGTTGATCAGAACGGCGTGGTAGACTTGCAAAGCCAGGCTTACGCTGCCACGGCCGCGCTCACAGC
GCGGCGGGTATCGCAGAAGCCAGCCAACGGCCATCTCGACGGAGAGCACTCACTGGGCAGCGCGGCCTCGGGAATGTACA
CGCACACGTCGTCGGGAGGCTACCCGATGCTGGACGACGGACAATACCAGAGCCAACACCTGCAGCCGTTTGGCGCGTCC
GGAACGTCGCCCAGTCGTGCTGTGTCGCCTTTGAATGGCGACCGCATGGATCCGCAGAACCAGGACCAGCTCCTAGCCGC
AAACTCGAGCCTGAAGACCCGCGTGGCTGAGTTGGAGGTCATTAACGACTTTATCCAGCGCCGGCTGGGCCACTACGAGC
CGCCCTATGGGACAGGTCAGGACGGCCAGGACGCAAACCACCAGGCTATCGAGGCGCAGCTGCGATCACAGGTCGAGCTG
CTGACGCAGTCGGAGACACAGCTGCGCTCGCAGCTCGAAGAGAGCCACCGGCGGGAGAACATGCTGAAGCGGCGCCTCGA
CGAATTAGAGCTCGAGCTGACCGAGTCAAAAAATGCCCTCGGCGCCTACGAGAGCGGACGGATCAAACGGCCGCGTCTCT
CATCGCCGGTAGCCGACGTACCCGCCGACGCATTGGTAGAAGCGACGACAGCAGACGTTTGCGCAAACACGAAAGGCACG
ATTGAGGACGCTAGCCTGACCAAGGACATTGATGTCAACAATGATGTCAGCAACGGTGCCAACAACGATATCGGCAACGA
TGACAATAAAGCAGTTGTTTTTCCCGAAGAGGCAGACAAGAAGATGGCAGATAGCGACGAGATTGCGGCGATCGAAGCGA
CTAAGGACGTGCCAAACGGCGCCTCTGGGGACGAGGCCACCGTCACAATGCAGACAGCGAAGCAAGCCTTGGAAGAGACT
TCCCAACTGTCAGAAGCGATAAGGCCGAGCTCACCCAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62