GenePrediction:GLEAN_2578 Details

Name: GLEAN_2578
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1980937..1982354 (+ strand)
Length: 1418
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1980937..1982211 (+ strand)
Length: 1275
Type: CDS
Source: GLEAN
Position: GCSC_140:1982271..1982354 (+ strand)
Length: 84
>GLEAN_2578 class=GenePrediction position=GCSC_140:1980937..1982354 (+ strand)
ATGCAGTCCATCTTCCAAGTCCAGCGGCAGGTGAGGGCAGACCTTGGCCTGGAGAAGGTTCGCGTCATTCTCAACAAAAA
CTACAAAGCAAACGGCACAAAGTCCTATGTCCATCTCTTGAACCGGTACGGCTTTCAGCCGACCAAGCCTGGCCCTTACC
GTCACGTCAACCGCGTTCACCAGCGCGGGCTTCGTGTAACCGACATTACGAAAGTACATAAGCCAGTTGGTGGCCGTGTT
CATCTCGAGAAGGTGCTCGCTAAGCACTCGGCAACAGGAGATGGGAACACACAGGCCGGCGAAGTGACTGCAGAGGATCA
GCAGAATGATTCCATGTACCTGTGCGAAGTCGAAATCGGCACCCCTTCGCAAAAGCTCATGCTTGATTTCGACACAGGCT
CATCCGATCTCTGGGTCTTCTCCACAGAGCTCTCTGCAGACGTACAAAAGGGGCACGCAGTCTTTGATTCGTCAAAGTCA
ACGACGTTCAAAACGTCCAGCGGCCTAACTTGGCAGATTGAGTATGGTGACGGGAGCTCTGCGTCGGGTGACGTGGGCAC
CGACGTGGTTACCGTTGGTGGCCTTGTCATCAAGAACCAGTCTGTAGAACTTGCGAAGACCTTGGCGGCACAATTTTCAC
AAGGTACTGGAGATGGACTGCTTGGTTTAGCTTGGCCATCGATCAACACGATCAAATCGGGTTATTCGTCCGACCCACAG
CCCACTCCTGTTGCCAACATGATATCCGAAGGTGTTGTGCCCAAGGAAGCCCAGCTGTTCACCTCGTGCTTTTATGGCGA
GCGTGACAACCAGGAGTCTTTCTACACATTCGGCTACATTGACGAGGACCTTGTCAAGGCTTCTGGTGCAGAAATTGCCT
GGACCAGCATTGACAACAGTCAGGGTTTCTGGATGTTCCCGTCGACCTCTGCATCTATCAATGGCCAATCTATCACACTT
TCCAACAACACAGCTATTGCTGACACCGGCACCACTCTTGCACTGGTGTCTGATGAGGTTTGTGAGGCGCTGTACAAAGC
CATTCCGAATTCCAAATACGATGAGAAGCAACAGGGCTACCTGATCCCCAAAACCACGACGATAGACCAGCTTCCGACCG
TTTCTATTACTGTTGGTGACAACAAATTCGTCGTTCAAAAAGAGGACCTTATCTTTACCCAGGCAGATGATACTCACTGG
TATGGAGGCATCCAATCTCGTGGGAGCAACACATTTGACATTCTCGGGGATGTGTTTCTAAAGTCAATCTATGCTGTGAG
TTCTCTGCAAGTTCGCATAAGTCAAGAGACAACTAACTGACGATGTGACTTCAGATTTGGGACCAAGGCAATGTCCGCTT
TGGGGCTGTTCCCAAGATCCAGAAGACACAGACTTTGGACCCTGGATCGAGCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62