GenePrediction:GLEAN_2579 Details

Name: GLEAN_2579
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1984839..1986912 (+ strand)
Length: 2074
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1984839..1985003 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_140:1985100..1986081 (+ strand)
Length: 982
Type: CDS
Source: GLEAN
Position: GCSC_140:1986143..1986616 (+ strand)
Length: 474
Type: CDS
Source: GLEAN
Position: GCSC_140:1986677..1986912 (+ strand)
Length: 236
>GLEAN_2579 class=GenePrediction position=GCSC_140:1984839..1986912 (+ strand)
ATGGCACCGGCGACGACTGCGACTGCTGTGGGCGTTTCCGGCGACTCGACATTCTGGGACCGCGTAACAAAGTGGGCCTC
CGAGAACAAGACGGTCGTCTATACTGCTGCCGGTGTTGCTGTTGTTGTCACCGGCGCGGGGGTAGTATACTATCTGAATG
CTCGAGTGCGTGCTCTCCATATTTATTTTTGACGACTGGCGATGCCGGCTTGATAGCGGGTGAACTCTGTGTTTCAAGCT
AACACTAACTTTGAACTGCAGCCATCCGAAGGCCAGGCGGGTCACAAGCTAAGTAAGAAAGAGCGGCGGAAACGGAAAGA
GGCCGAGCGGAAAGCAGCAGCCGCAGCAGAAAAGGCCATAACATCCGGGAGCGATGCCGGCTCCTCCAAACAGTCTGCGA
CCGCATCGGTTGCGGCTGAGGAGGAGCTACCAGAGATCACCGAGACCACCGTTCAAGTAATGGACGCCGAGGAGCGCAAG
AAGATGGCACTGAGGTTGAAGGAGGCCGGCAACAAAGCTTACGGAGCGAAGAACCTCGAGGGGGCTATCGATCTTTACTC
CAAGGCCATTTTATGCAAGCAGGACCCGGTATATTACTCGAACCGCGCAGCCTGCTATAGCGCATTGAGCGAGTGGGACA
AGGTAGTTGAAGATACTACGGCGGCCATCAATATCGACTCCGAGTACATCAGAGCGCTGAACCGGCGCGCGAATGCCTAC
GACCACCTAGGCAAATACCGCGAATCGCTTCTCGACTACACAGCCAGCTGTATAATTGACGGATTCAAGAACGAAGCCAG
CGCCCAGGCCGTGGAGAGACTGCTGAAGAAATTTGCCGAGACAAAGGCGAAAGAGCTGATGGAGACTCGACCAGCAAAGC
TGCCGAGCCCTACCTTTGTTGGCAACTACTTGCAGAGCTTCCGAGCCAAGCCGCGTCCCGAAGGCCTCGATGATGCGGCT
GATTTGGATGAGAGTACTGGCAAGGGTCAGCTGCGGTTGGGCCTGCAGTCGCTGGAGAAGAAGACGGCTGACGGGTATGA
GGAGGCTTCCGCGGCATTCGAAAAGGCGCTGGAGCTTGGGGACCTGGGCGAGTATGAAGCTCTGGCCTACAACTTGCGCG
GTACTTTCCTCTGTCTCCTTGGCAAGCATGAGGCGGCTTTGGCGGCTCTGACTACAAGCATCGAGTTGGACGAGACCATG
ACGCAGAGTTATATCAAGCGCGCCAGCATGAACCTTGAACTTGGTAAGTTTCCACGCTCATGAGAGGCCATGAAGACAAT
AGTGACTGACACGCATGCGTATAGGGGCGCCTGCCAAAGCGGAGGAAGATTTCGCCAAAGCTTTGACTCAGAACGACTCA
GACCCAGACATCTACTACCACCGAGCCCAGCTCCACTTTATCAAGGCAGAGTTTGGTGAGGCGGCCAAGGACTACCAGAA
GTCGATTGACCTTGACCGCGACTTCATCTTCTCCCACATCCAATTGGGAGTGACGCAGTACAAGCTCGGATCGATCGCCT
CGTCTATGGCAACATTCCGGCGCTGCGAGAAGAACTTTGCCAAGGTTCCGGACGTGTATAACTATCACGGCGAACTGCTC
CTAGACCAGACCCGGTACCAGGATGCTATCGAAAAGTTCGATAAAGCTATCGAGATGGAGAAGGAGACGAAGCCCATGAA
CATGAACGTGCTGCCTCTTATCAACAAGTCACTCGCTCTGTTTCAGTGGAAGCAGGACTTCTCCGAAGCCGAGAAGCTGT
GCTCAAAAGCCCTGATCAGTAAGTCATCCCTACACGGCCTACGTACATACAGCTTGCTAACCGCGCGTCACTGTGTAGTC
GACCCGGAGTGTGATATTGCGGTAGCCACAATGGCACAGCTCCTCCTGCAGCAGGGCAAGGTGACAGAGGCACTCAAGTA
CTTTGAGCGGGCATCAGACCTGGCACGGACGGAAGGCGAGCTCGTCAATGCTCTGTCGTATGCTGAAGCGACACGAACAC
AGATCCATGTGCAAGAGAAGTATCCGGCTCTAGCTGCCAAGCTGCAGGGTATGAGTGGCCCCGGCTTGCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62