GenePrediction:GLEAN_257 Details

Name: GLEAN_257
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:582911..583856 (+ strand)
Length: 946
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:582911..583058 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_167:583123..583856 (+ strand)
Length: 734
>GLEAN_257 class=GenePrediction position=GCSC_167:582911..583856 (+ strand)
ATGGATGTTTTGGGCACCGTCTCCAGCCTGTGCGGCTGGGTCTACACCCTCGCCTGGTCGCTTTCCTTCTACCCGCAGCC
GACGCTGAATGCGCGCCGTCGGTCGACGAGCGGAACGACGATTGACTTTCCGTTTATCAACACTCTAGGTATCTCTGGAT
TTCCTTTCGGTGGCCGACCGGCACTGACGCTTGTTGTACTGTGTCTCTCTAGGCTTCCTCGCCTACCTGCTTTCCAACCT
GGCGCTGCGCTACTCGGCCACCGTCCGGGGCGAATATGCGGCGCGCCACCACGGGCTCGCGCCCACGGGCGCCTTCAACG
ACGTGGCCTTTGCATCGCACGCCTTTGTGCTCTCGCTCGTGACGGTGTCGCAGTACTTCTTGCCGACCTGGTGGCGGATT
GCGGCCGGCCCAGGCTCGGGTGTCAGCCGGCGGCCGTCGCGCTTCATCCTGTTCGTGGCGGCCGGCTCGGTCACCGTGAT
CGGTGGGCTCGTCGCGGTGGTGCTGTACGAGCACAGCGGCTCGGCCGTCGGCTCGCCGGCCGGCGCGTGGGCCTGGCTCG
ACGTCGTGTACGCGCTCGGCTACGTCAAGCTCGTCATCACGCTGATCAAGTACTCGCCACAGCTGCTGGCCAACTGGCGC
AACCGCAGCACGCACGGCTGGAGCATCGTGCAGATCATCCTCGACTCCGTCGGTGGCGTGCTCAGTATCGTCCAGCTGCT
GCTCGACAGCTACAGCCAGGGCGATTGGTCCGGCCTGACCGGCAACCCCGTCAAGCTGCTGCTCGGCAACGTCTCCATCT
TCTACGACATCCTCTTTATTGTCCAGCACTTTGTCCTGTACAAGAGCAGCGGCAGCGATGGAGATGACGGCGACGGTGCC
GACGGCCTCGACAGCGGCCGCGCGGCCGTCACCGGCAGCACCAGCGAGCGGGATCCCCTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62