GenePrediction:GLEAN_2580 Details

Name: GLEAN_2580
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1991922..1995296 (+ strand)
Length: 3375
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1991922..1992226 (+ strand)
Length: 305
Type: CDS
Source: GLEAN
Position: GCSC_140:1992314..1995296 (+ strand)
Length: 2983
>GLEAN_2580 class=GenePrediction position=GCSC_140:1991922..1995296 (+ strand)
ATGGAAGGCGCTTTCACGCATGTGGGAAACCACTTGATATCCGACTCGGCAGCTGCCATCAAGGCTGGCGACAACGACGA
CCTATCCACCATCGACCCGGAAGAGAATCTCTTGTATGGCAAGTTTGGTGGCCGGGCTGGTCTAGGTGGGGCAACTCGCC
GACGCCATGACGATGATGATAACGGTACAGAAGTCTACGATGACGAGGATGACGAGAGCCTGGCCAGCGTGCCGGTCGAC
GGTGTCCAGGGTCTGAAGCTCGGGGCTGAAGAGGAGGAGAAAGAGCTTCCAGCCCATGCCTGCGCGTGAGTTCTGGACCT
GAAGCCGTCTTGGATGTGTGGTTTGCCTCCCTGTATCGTGGACGGTAATGCTGACGCGCATCTCTTCAAAAGATATTGTG
GCATTCACTCCCCGGCCTCTGTGGTCAAGTGCCTGGCTTGCAACAAATGGTTCTGCAGCGCGCGCGGAAACGCAACGTCC
TCCCATATTGTCAACCATCTCGTTCGTGCCCGCCACAAAGAAGTACAGCTGCACCCCCAGTCGTCGCTGGGTGACACCGT
TCTCGAGTGCTACAACTGCGGTACCAAGAATGTGTTCTTGCTTGGGTTCATCCCGGCCAAATCCGATACGGTCGTGGTTC
TTCTCTGCCGTCAGCCCTGTGCGGCCAGCACATCGTCCAAGGATATGAGCTGGGACATCTCGCGCTGGCAGCCGCTTATC
GAGGACAGATCTTTTCTGCCCTGGCTCGTTGCTACACCTACAGACGCCGAGCAGCTCCGTGCCCGGCATCTGACGCCCCC
GATGATCGCCAGACTCGAGGAGATGTGGAAGGACAATGCCAACGCCACAGTCCAGGACCTTGAACGGGCGGCCAGTGTAG
ACGATGACCCACAGCCGGTTCTGTTGAAATACGACGACCCGTACCACTATCAGAACATCTTTGGCCCGCTGGTGAAGATG
GAATCCGACTACGACAAGAAGCTGAAGGAGGCCCAGTCGGAAGACAATCTGGTGATCCGATGGGACTACGGCTTGAACAA
CAAGCACCTGGCCATATTCATCCTGCCCAAGATCGAGTCGGGTGACGTCAAGCTTGCCGTCGGCGACGAGATGCGGCTGA
AGTACAAGGGCGAGCTGCGTCCTCCCTGGGAGGGCGTAGGATACGTGATCAAGATCCCCAACAATCAGTCCGACGAAGTG
AAACTGGAGCTCCGTAAGACGGGGAACGACAAGTCGGTACCTACCGAATGCACCCACAACTTCTCTGCGGACTATGTGTG
GAAGGCCACATCTTACGATCGCATGCAGATCGCCATGAAGACGTTTGCTGTGGATGAGATGAGCGTGTCTGGGTACATAT
TTCACAAGCTTTTGGGCCACGAAGTCGCCGTCGCCCCGATGAAGACGTCTCTGCCTAAGAAGTTCACGGCGCCACAGCTG
CCCGAGCTGAACGGCAGCCAAATCAGCGCTATCAAGGCTGTTCTGTCCACGCCTCTCAGCTTGATCCAGGGCCCTCCGGG
AACCGGCAAGACGGTGACTTCGGCGACCATCATCTACCACCTGGCCAAGATGAACAACAGCCAAGTGCTTGTGTGTGCAC
CGTCCAACGTTGCCGTCGACCAGCTCTGTGAACGGGTCCACCGGACCGGCTTGAAGGTTGTCCGGCTGACGGCAAAATCT
CGTGAGGACGTAGAGTCCTCTGTCAGCTTTTTAGCGCTTCACGAGCAGGTCCGGATGAACGACACCAACGTGGAGCTGAC
GCGCCTGCAGCTGCTGAAGAATGAGGTCGGCGAACTGTCGAGCTTGGACGAGAAGAAGTTCAAGCAGCTGACGAAGGCGG
CCGAGAAAGAGATCCTCAACAATGCCGATGTGGTCTGCTGCACCTGCGTGGGTGCGGGCGACCCTCGGCTTGCCAAGATG
AAGTTTCGCAACGTGCTGATCGACGAGTCGACGCAGTCAGCGGAGCCGGAGTGCATGATTCCTCTGGTTTTGGGCTGCAA
ACAGGTGGTTCTTGTCGGCGACCACAAGCAGCTCGGCCCGGTGATCATGAATAAGAAGGCAGCCAAGGCGGGCCTGAACC
AATCGCTCTTTGAGCGCCTGGTCAAGCTTGGCTTTGCGCCCATCCGGCTGAACGTGCAGTATCGAATGCACCCCCATCTT
GCAGCATTCCCGTCGAACATGTTTTACGAGGGATCGCTCCAGAACGGTGTCACGATCCAAGAACGTCTGCGGAAAGACGT
GGACTTCCCGTGGCCGGTAGTGGATACGCCGATGATGTTTTGGTCGAACCTGGGCAACGAAGAGATCTCGGCATCGGGCA
CCTCGTATCTGAACCGAACAGAAGCGTCCAACGTCGAAAAGGTGGTGACCCGCTTCTTCAAGGCCGGCGTGAAGCCCGCA
GACATTGGTGTGATCACTCCGTATGAGGGCCAACGCAGCTACATCGTCACGACGATGCAGAACACGGGCACATTCAAGAA
GGAGAGCTACAAGGAGGTAGAGGTGGCCTCAGTCGACGCCTTCCAGGGCCGCGAGAAGGACTACATTGTGCTGTCGTGTG
TGCGGTCCAACGAGAACCAAGGCATTGGTTTCTTGTCGGACCCGCGCCGACTGAACGTGGCTCTGACGCGTGCCAAGTAC
GGCATTGTTATTCTGGGCAACCCCAAGGTCTTGGCGAAGCACGAGCTCTGGTATCACCTGCTCGTGCATTTCAAGGACCA
TAAATGCCTCGTCGAAGGCCCGCTCAGCAACCTTCAGCCGTCGCTGCACCAGTTTAGCAGACCCAAGCACAGCTACCGGC
CGCCACGAGCGGTGGGCAACGACGTCGTTCACAACGGACGCTTCGGACAAGGACAAGGCCAGGGCAACAACGGGATGATG
CGCGACTTTGAGACCGGTTCTATCATGTCGTACATCCCCGACGATGTTTCCTCGATTCACAGCTCGGCTCTGGGAGGTGC
CGGCCTAGGCTCGGCATACCCAGCGATGTTTTCCAGCTTCAGTCCTGACCAGTGGCCTGGCCTGCCGGGAGCCAGTCTCG
GCGGGCGGGCCGGTGGCAAGGGTCGAAACAGGGGTATCGCCGAGAGTATTGCTGGCGAGAGCGTAGCCAACTCCGAGTTC
ACGGATGTGACGGCGAGCTCGAGCGTCATCGGAGGCAAGGGCGTCGGTCAGGGAGGAGCCAGCCTGGGTGCAGGGCTGCA
CGACGCAGTTAGCAGCGGTAGACTGGCGTCCTACAGCCAGAGCGACCGTCTGAAGCAGTACGTGGAGAGCAGCGGACGCA
TAGCAGCAGGCAACGGATACCGGCGGTACGACGACGACCAGCAGAGCATCAGCACGGGCTTTGCCAGCCAAATTGGAGGA
CCAGGCTATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62