GenePrediction:GLEAN_2581 Details

Name: GLEAN_2581
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1996249..1997036 (+ strand)
Length: 788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1996249..1996518 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:1996578..1997036 (+ strand)
Length: 459
>GLEAN_2581 class=GenePrediction position=GCSC_140:1996249..1997036 (+ strand)
ATGTCGGGCACAGATGAGCCAGTGTCGGCTGCAATTGCGGTCGCGGTGACGAAAGAGGCACCGGGAGCACCAGAGGCCCA
AGACGACATCAACCCGCCAGACTTCGACGGCGCAGTGCGCACCAAAAACACGTTGCCGTCGCGGGACACGTTGCATCGCA
TCGCCGACCTGCCGGTGCTAGACCGCGAAGGGAAGCCACATCCGTTCAAGAGTCTGTACGCGGAGCGAGGTCGGGTGCTG
ATCGTGTTTGTGCGGCACTTTTTCTGCGGGGTACGTAATCCCGTCCTCGTCCTCTCGATGCCGGCTGACACGAGCATGCT
GTCCGGCAGAACTGCCAAGAATACCTGCGTGTGCTTTCGGCAAGCATCACGGCGGACGCGCTGGCCAGGGCGGCGGGCGG
TGCCGCTCGCATCGTCGTCGTCGGGTGCGGCGAACCGCCGCTGATCGACATGTACGCCGAGGCGGCGGCGTGTGCGTTTC
CGATCTACGCAGACCCGACACGGCAGCTGTACGACGAGCTGGACATGGTCTCGACGCTGGCGCTGGGCGAGAAGCCGGCG
TACATGGGCAGAACGTCGATGTGGGCGTCGATTGTGCGGTCGATCAGCCAGGGCCTGCGGCAGATCCCGCAGGGACTCGT
GCTCAAGGCCGGTAACCAGCGGCAGGTCGGCGGCGAGTTCTTGTTCGAGTCGGCGGCGGACGTTGAGGTCACTTGGTGCC
ACCGGATGAAGACGACGCGGGACCACGCCGAGGTGGCGGAGCTGAAAAAGGTGTTGGGATTGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62