GenePrediction:GLEAN_2582 Details

Name: GLEAN_2582
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1998771..2003940 (+ strand)
Length: 5170
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1998771..1999546 (+ strand)
Length: 776
Type: CDS
Source: GLEAN
Position: GCSC_140:1999603..2001348 (+ strand)
Length: 1746
Type: CDS
Source: GLEAN
Position: GCSC_140:2001909..2001937 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_140:2002084..2002479 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_140:2002622..2003940 (+ strand)
Length: 1319
>GLEAN_2582 class=GenePrediction position=GCSC_140:1998771..2003940 (+ strand)
ATGGCCACCGCCGCCAGTCCCGCCGGCCGTGCTCCCAATGCCACTGCCAAGAACGATGGGCCTCGACGCCGAAAGCTGAT
CGGCCAACGTCGGCGCGTAGATGACGACGACGGCGACGATCACGGCACATTCGATCTGGTCGACGACGACTCTCTGACCG
ACGCTTCGGCCGCCAGCGAGGATCGGGATGCGGCTGTAGATGATAGCGACACAAGCAACATCGACGATGCATCGCCAACC
ACACCGGCCACCCGCAAGGGCATCAAGAGCGGGGCGGGCCCAAAAGGTGCAGCAGTCAAGCCGGAGGGACGAAGGCCGAC
GGAGCCTACGGACAGTGCTGCTACACCCAGCGCTGAACATATGCTGCGCGGACTGTCGATTTCAGACAAGACGGCGACGG
CCGCAAACGAGCAGCTTGACCGTGACGCCAGCGAGGCGAAGGAGAGCGGCAACGGGCCCGCAGACGCGTCCCAAGCCGAA
TCCGCATCACAGCCGCAGCAGCCTGCTCAACCGGTCAAGGCACCCCAGCCGCCCATCGTCTCCTCTTCTTCCGCCCAGGC
CCAACGCCGCGAGACGCCCTACGAGAGACAGCGCCGCGAGCACGACCTCTACAAGCAGAAGCGGGACGAGGACCCGTCGT
TTGTGCCCAACCGGGGGGCTTTCTTCATGCACGACCATCGGGGTGCTGGCCCAGCTGCCAACGGTTTCCGGCCCTTTGGT
AGGGGTGGAAGAGGCCGTGGTCGGGGCGGTTACGGAGGGCTGTACGCCCCATTGCAGTATGTAATCTGTTCTGGCTGATT
GCCGTCTTTTGCTGACTGAATGATCTCGACAGAGGCCATATACACAACCCGGCAGACCCGACGATCAATGCCCCGTGGGC
TCACGACATGCACGACACCATTGCGGCACCGGTCATGCCGCGACTGGCGCCACCACCACGCCGTCGTTTCGATGCGAGCA
GTCAGTATGGCGGAAGCCAGGCTGTGGCCCCTGCTGCGAGCATACCGACATGTCTGCCCAGTGCCGTGCCCATCAACCGG
TCCATGTCGGTGGAAAAGCCGCTGGGGGTGGTGACTGTCCGGGTATTCTTCCCGCCTATGAGAGAAGCGGTGCTGTTTGA
GAAGTTCAAGGTTGTGCAATACACTAAACTGCCAGATCACCGGCCACCGCTCCGACGGGACAAGGCCGTGGTCATTGATC
TCCCGGGCCAGCCGAAGAGCCAGATCTTCCCGGCCGTGGACCGCTCGTTTATCTTCATTCCCCGCGCACTGCGTCCGAAC
CAACAGCGCATGCGCGGCAACAGGACGCGGTCTGTCATGGGCTCCATCTCCGGCTTCTCGCGACAGACCAGCATGTTTGG
CGGCAGCTACTACAACGGGAGCATGTACTCGCCCAGCATCGCGCTCAGTCGGAGGTCGTCCATCACCCACGACGTTGGCC
GCGACTACATCATATCTCCTGCCGGGTCAGCCATGTCCCGACCAGCCCTCCACATCGACAACGCCTCGAGACCGGTCGTG
CGGCTACCGCCATCGGGTGTTCCACCTCCTGCTATGCCGATGTCGGTGCCGATGAGCGGTCTAGGCATATCCATGGGTGC
AGGTGGCGGTGTTTCCGTGTCCGTGCCGCCACAGTCAGGGGCTAAATCTACCCCGCAGGCAGAACAGCAGCAGGCAGAAC
AACAACAACAACAACAGCAGCAGCAGCCGCAGCAGCAGCCTATACCGCCATCCCAGGTGCCAGAGGGCTCTTCGCTCAGC
ACCGTTCCTCCTCCACAGATCCATCCTCTACCCCAACGGCCTGCATTTCAGGAGAGCCGAGCAAGCCAGAACCTGCCTAT
GCACCAACCACGACCGCAGAAGGCAGTGTCGGTCGACACAATCGATCCCCAGTCGACCGGGGGCTTGGGGCCGTTCGCGC
AGCAGCAGTCTCTACCCATGCCGTTCCACCAACAGGTTCCCATCCAGATGGCAAGCGGCTTTCCGCCAGGAGAGCCCCAT
CAACGCCACCCGTCGTATCCGTCCTACACTGCCGGCACACCGCTGTCGCAGATTCCAGAGCGCGCCATCCACGCCGCTCC
CTTCCAGCCGAACATGTCTGCTCAGCCGCCGATGTATTCGCAGCCAAATGCAGCGCCGGCAGGAGCCACTTTCTATGGCA
ATCCTGCGGGATATCCGATGATGCAGCCGCCTCCACAACAGGGATTTTTCTACCCAACACCACCCACCTACTCCTCTACC
ATGGCTCCGTCGGGGGCAGCTGCGACGTTTGTACCTGGAGGAACACCGCAGGGTGCTGGGCCACCGTCTGGCCAGCCAGG
CCAGCGCGATGTCGGCGGGACACCGGTCGACGTGCAGCAACAACCGGTCCCCCACCACAGCCTGGTTGCTCAGGAGGCCA
ACGGCATGGTGTACTACTACGATCCATCCAGCCTCCCTGGCATGTCCAACTATCCGTCGTATGTGCCGACTCCAGCTCCC
CCGGGCGGCTTTGTGCCTGGCATGGGCGGAATGGTGACGCCGACTCCTGCCGATAGTTACTACTACCCGCCACAACCGGG
GATGGTGTACTACCAGCAGTAAGTCTCTGTGTTGGGACGGGCTACATTCGCTTGGCTGTTTTCTGGCTGTCGTCTACCGC
CGTTCATTCGTTAGAGCAGAGGGAGCAACGTTTGCAAATTCGCGTTCTTGGGCTATCATTTTCCCGGGAAAGGTTGGGAA
GGAAGCAGGAACTTGGCGCATCTTTTCCACTTCCCGTTTTCAAGCTTTGTTCTCTCACCTTCTTTTTTCCTTTGAAATAT
CAGTTGATGATCCTTCCTAATTTTCTAACACACGAACCGCCCTGCTTCTCCACCTTGTCCCGGCAGACGCTCGTTCTGCT
GTGCCTGACACGGCTTGTTACTCTTCTCTCTCTCTCTCTCTATTTCAGTCAATGTATCTACCTTACCTGTGCTGTATCCA
GTGGAGGAATCCGCCCAAGAGACAATCCAATAAACAGGCAGACAGAGGTAAAGGAGAGTGTGGAGTTTGGTAGTATACAT
GAAAGGAGAAGAGACCAGAGCTGAGAAGAAAAGATAAGAAAGCGATAATGCTGTTTCCAGGTCTAGCTGTGTTCTTGTGG
CTTCTCGTTCGTGCCTAGTCCGTACTCCGCACAGCTCGCTGAAAGCCGTAAACGGCACCTCTAGCGCTCTTGGCGAAGAT
GACCCCATATAATTACGGGGTAGCTTTGGAGCCATCCGACAAGGGGTCTTTTAAAATACAAGTACAGCTGCTCCAAGCCA
TCAACACCTGAGTCAAGATAACATTATTTACAGCTCGCGTTGCTACGAAGTACCAAGAGCGGATAGCGATGGACGACGGA
ACAGGAACACCTTCGCTTCCACCGGCTTTTGCGGCAGCTATGGCGGCCCCGACAGCTTGCTCTTCAACCACGTCAGCAGT
GCAGGCTGCAGTTGGGGCCCCGGACTTCAGGCCTGCAGCAGCTGGTGTAGAGCCAGTAGTGACACAGCTGCATGCGCCGA
GCGGACTTTGTGTCTTTTCAGGTGGTACTGCCGCTAATTCGCTGGTTGATGCGTTCCAGGCCGTGGCAACATTTTTGGGC
AACGACGGGAAGAGCAACAAGACCAGATCGTGTCCGTTGGAATATATCATCCCGATTTCCGACAATGGAGGCAGCTCTTC
AGAGCTGATCCGCTTCTTTGGCGGGCCCAGTAAGCAGTGTGGCCAGTGACGTCTGTTCTCTCTCAGTTGCTAACCGAGGC
CTGCAGGCGTGGGCGACATACGAAGTAAGATGTGTATGAGTCTTCAGGCCCCTGAACAGGCTCGGCTGACAAGCGGACAA
AGGTCGTCTAGTGCGCCTGATACCAACGGGCGATGACGGGGACGGCGACCCAGATGCCGCGGCCCTGCAGAGTGCTGCTC
TCTCGGCAGCGGCCAGCTCTCGCGCTGCCCTGCGTGCCCTCATGGAGCACCGGCTCTGCACGTCGGATCCTCGAGAGGCC
CGGGCGGAATGGCTCGATCTCGTCGAGGCGCGCCACGGGCTCTGGACGTCTGTTCCCGGGCCGACGCGCGAGCTCATCCG
AGCGGTGCTCAACACGCTCAACCTCGAGATCGTCAAGCGGGCGCGGCCAACGTCCGTCTTCAACTTTGCCGGTGCCAGCG
TGGGCAACCTCTTTCTGACCGGGGCCCGGCTCTTCTCGGGCTCCTTCGAGGCCGCCATTTATCTCCTGTCGCTGCTGTGC
GGCATTCCTGACCACGTGGCCGTGGTGCCGGCTATCAGCTCCAACTTTACACATCACATTTCGGCCGGACTGGTCGATGG
GACCACCATTGCCGGACAAGTCAACATCAGCCACCCGTCCGCACCGACGTCGCTGCCAGACGGAACTGTCGTGGCCCCGG
TGGCGACAGCACCGACAGCGCCGACGGCGGCGACGGCCACGACGCTCAAGATGCGCGGGCGAGCTGCGACGGCCATTGAC
TTTGAAGACGCCACGCTACCGGGATCCCTGCCAGTGCTGCGCCGTCCACAGATTGCCTTTAGCAAAGACGACGAGGAGGA
CCTGCCGGCACGGATCGAGCGGGTCTGGTACATCAACCCATACGGCCACGAGATCCGGCCGCCAGCCAATCCCAAGGCGC
TGGCAGCGCTGCAGCGAGCCCGTGCGATCGTCTACAGCATCGGCAGCCTATACACGAGCATCATCCCGAGTCTGGTCCTG
CGGGACGTCGGCGCAGCGATCAGGGGTGATGACGGCGACCACGGCCAGCAGCACGGGCGGGCCAAGGTGCTCATCCTGAA
CAGCAAGCTCGACCGCGAGACGGGCCCCCAGCACGACCCGATGACGGCCGTCGACTTCGTGCGGGCCATCACGGGTGCGT
GCCAGCAGAGCCAGCAGGACTTGGGCCCAGTGCAAGACGAAGACTGCCGGCGATACGTGACGCACGTGCTGCATCTAGAG
GGCGGCACGAGAGGAGGCAAGACCAGCGCCGCAAGCGGCCCTCTCGTCGACGAGGCAGAGCTGGGCCGACTTGGCATCCG
CTGTGTGGCTGTGCCGAACCAAGAAAGGCGCCCGAGAGGACATGGCGGCTTGGGGATGGGGCGATACGACGAGGAGGCAC
TTACACGGGCACTGCTAGGCGTCATCGGCGAGCAAGGAGATGGGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62