GenePrediction:GLEAN_2585 Details

Name: GLEAN_2585
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2014422..2016223 (+ strand)
Length: 1802
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2014422..2014429 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_140:2014492..2015153 (+ strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_140:2015222..2015260 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_140:2015325..2016223 (+ strand)
Length: 899
>GLEAN_2585 class=GenePrediction position=GCSC_140:2014422..2016223 (+ strand)
ATGCCTAAGTATGGCCTAACTCTTTTACTCGGTTGTGACTGTGAACGGTAGATTTTCTAACACGGAAAAGCCCCGGCGAT
CAACATACGATTGTGAAGAATCCTTTCCAGGAAGTCGCGCCACGCATGTCCGAGTATACAGCACAGGAAATTGCGACGCT
GCAGAACCGATTGGAGAAGCAATTGGGCCCCGAGTACCTGTCTGCCCGTTCTGGTCCGTCTGGCCAGAAAGTTCACTATA
TTGCCGCTGAGAAGGTCATTGCTCTGGCCAATGAGGTGTTTGGGTTCAATGGCTGGTCTTCCTCCATCCAAACGATCCAG
ATCGATTTTGTCGACGAACATCCCCAGACACTTAAGATCTCCATCGGTCTATCTGTGATCGTGCGTGTCACCCTCCGCGA
CGGCTCCTTTCATGAGGATATTGGCTATGGCCATATCGAGAACTGCAAGGGCAAGGCGGCCGCCTTTGAAAAGGCCAAGA
AAGAGGGGACGACAGATGCACTGAAGCGCGCTCTGCGCAACTTTGGCAATGTCCTCGGTAACTGCATCTATGACAAGGCC
TATGTCGAAAAGGTGTCGAAGATCAAGGTGACGCCAAACAGAAAATTTGACGAGCGCGGATTGCACCGACACGCAGACTA
TGCCGTCAAGGTAGAGGAGCCGCCGGCAGCACCGCCAGTTTCGGCGGCAGCTGCAGTTCCCAAGGCCGAATCAGTATCTG
CTTCTACTTCTGGTGGGCACCCATACCAAACGATGCACGCTGCACGAAAGCCTGTAGACCTAACTGACAAACGTGCATAG
CATTCGCAATGGACCCATTCGACGAAGACCTGTTAGGAGGTAAGTCTACGCTCTTGCAACGCACAACAGTATAAGTCTAG
ACTCTGACACCGGCGCATAACAGACTTTGATGAGGCAGATTTTTGTGTGACTGAGGAGGGCCACCCCGACGAATTCGCAG
TCCCTAATCCATCGGTCCCATCCTTGCCACCGCCCGCACAACGGTTTCAGCAGTCAAGAAGTGTCAGCCCTGTCCGCCAA
ATTCAACCACCACAGCGCCCAGCGGGCAATGCTAATGTCCCGCGGCCACCACAAACACCTAGGCCTAATGGCGGTGTCGG
AGGAGGCCGGTCGTATCAGGCAGCCAACCAGGCAGCCAACAAGCCGCAGCCAGCTGGCCATTACCAGGCGGGAAATGCTG
CACCACGGCAGAACATGAACAACGGCAGCAATAGTGGCAATGGCAACGGCAACAACAGCAAATCGGTCAAAGAGGAAGAA
GGCACGCCGTGGCTATCGGCCCGGGCTATTGCCAAGGTTGGAGAGGGCGATGCTCTGGCTGCCGTTGCGCCTTCGGTTCA
GGCAGGACATCTGTTCAATCCCAAAGCTGAGAGCCCATCGATTCGCAAGACTCCAGGTGTTGATCATAACAGCTCAAAGC
CAATTCCGAGAGTTCTTCGCCCAGGCGGACAACAAAGCTCGACACCTACGCCCGACAGGAGCCTCGGACACAGCACCGGT
GCCGGAAGCGTTGCAGTAATCACAACAGGGATTGGTACAGCAGCTGCTGCAGGGCCAGGGCGTGCCAACTTCAACCATTC
GATCCCAGAGTCGGCACGCCGCATAGGGGCACCTTCAAGCACGTCCAGCCCTCTGGCCAACCGTGGCCAATTCCGGCCAC
CGCCCATGAAACGTGGCCCGCCGGGCGATGCAGCGGCTACACGACAGCCGTTGTCAGAGGTGACTAGCAATGTTCCTACG
GAAGTTGGCGGCATAGATTATAAGAGACAGAAGCTTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62