GenePrediction:GLEAN_2586 Details

Name: GLEAN_2586
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2016625..2019112 (+ strand)
Length: 2488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2016625..2016657 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:2016743..2019112 (+ strand)
Length: 2370
>GLEAN_2586 class=GenePrediction position=GCSC_140:2016625..2019112 (+ strand)
ATGCTAGCCGGCCGCTCTGGGGCTCTGGCCAGGGTGAGTAACTTGCGATTCTGGACATGGGTCTTTTCAAGTTGGCTTTC
GCTTCTGCTCGCTAACACATTCGGTCGCGTTTGTTCAGCATCTTCGGCAGCTTCCTTCTCAGCGCTCCCTTCCGGCAGGA
ACGCGGCGGCTTTTCTCGACGGTAAACGATGCAGCTGCACTAACGCCCGTCTACGAGCGGCTGTATAACAAATATGCAGA
GGTTCGGCGGGTGCTGGGCCCGGACCGGCGCCTGACGCTGGCCGAGAAGATCCTTTACAGCCACTTGGACAACGTGGAGG
AGAATCTGCTCACAAACACGGACAACGGGCGGGCGATCCGGGGACAGGCGAACCTGCTGCTCAATCCAGACCGGGCCAAC
ATGCAGGACGCGTCGGCGCAGATGGCATTGCTGCAGTTCATGACGTGCAAGCTGCCACAGACGGCCATTCCGGCCAGCAT
CCACTGCGACCACCTGATCGTGGGCGAGAAGGGCGCGGACTCGGACCTGGAGGCGGGCATCGGGACCAACGGCGAAGTGT
TCGACTTTCTCGAATCGGCAGCCCGCAAGTACGGCATCGACTTCTGGCCGCCGGGCGCAGGCATCATCCACCAGACGGTG
CTGGAGAACTATGCGATCCCGGGCATGATGATGCTCGGGACCGACAGCCACACGCCCAATGCGGGCGGGCTGTGCACGAT
TGCCATTGGTGTGGGCGGCGCGGACGCGGTGGAAGCGCTTGTGGGGGCGCCGTGGGAGCTAAAGGCGCCTCGCATGCTAG
GGGTGCGGCTCACGGGCCAGCTGAGCGGTTGGGTGTCGCCCAAGGACGTGATCCTGCATCTGGCCGGGCGGTTGACGGTG
CGTGGTGGTACGGGCTTCGTGATCGAGTATTCGGGGCCGGGCGTGGACACGCTGAGCTGCACGGGCATGGCGACGATCTG
CAACATGGGCGCAGAGGTGGGGGCGACGACATCCCTGTTCCCGTACACAGCAGCCTCGGGACGGCACCTGGTGTCGACGC
GACGAGGACAGGCGGCACTGGATGCAGAGCGGCTGACGCAGTTCCGCGGCGTCAGCGGAGCATCCTTCCAGTTCGCAGCG
GACGAGGGCGCCGAGTACGACGAGGTGATTGAGATTAACCTATCGGAGCTGGAGCCACACGTCAACGGTCCGTTCACGCC
AGACCTGTCGATTCCGCTGTCGCAATTCGGCGAGACGGTGGTGCAGGAGCAGTGGCCGGAGAAGCTGTCGGCCGGGCTGA
TCGGCAGCTGCACCAACAGCTCGTACGAAGACATGACGCGGGTGGAGAGTCTGCTGAAGGCGGCAGCGGCAGCCGGATTG
CAGCCGGCATCCGACTTTTACGTGACGCCGGGCAGCGAGCAGATCCGGGCGACGCTGGAGCGTGACGGCACGCTGGAGGC
GATCAGCGATGCTGGCGGCGTGTTGCTGTCCAATGCATGCGGTCCCTGCATCGGGCAGTGGAAGCGGCGTGACGGGGTGG
AAAAGGGAACGGCCAACGCGATCTTCACATCGTACAACCGTAACTTCCGGGGACGCAACGACGGCAACCTGCAGACAATG
AACTTTTTGGCGTCGCCGGAGATCGTGACAGCACTCGCATTCGCGGGCTCGACGACGTTCAACCCGCTGACGGACGCGAT
CCCGACGGCAGACGGCGGCGAGTTCCGGTTTCCAGCACCACAGGGACTGGAGGGACCACCGCAGCCGTTTGACGAGGGCC
GGGCAGCGTTTGCAGTGCTGTCACCGGCACCGGACGCGTCGATCGAGGTGGCGATCTCGCCATCATCGGAGCGGCTGGCA
GTGCTGGAGCCGTTTGAAGCCTTCCCGGACGGCGACCTGGAAGGGCTCCGGGTGCTGGTCAAGGTGGCGGGCAAGTGCAC
GACGGACACGATCTCGGCAGCCGGGCCGTGGCTCAAGTACAAGGGCCATCTGCCCAACATCAGTGCCAACACGCTCAACA
CGGCCGTCAACGCGGCGACAGGCGAGGTCAACGTGGCCTATGACCTGGACGGCAGCCAGACGACGATCCCGGAGCTGGCG
CTGCGCTGGCGCGAACGCGGACAGCCCTGGCTGGTGGTGGCCGAGCACAACTACGGCGAGGGCAGCGCACGCGAGCATGC
GGCCCTGCAGCCACGCTATCTGGGCGCACGCGTCGTGGTGACCAAGTCGTTTGCCCGCATCCACGAGACGAACCTGAAGA
AGCAGGGCGTCGTACCACTGACGTTTGCCAACGAGGCCGACTACGACCGCCTCGAGGCTGGCGACGAAGTGGCCACCGTC
GGCCTGCACGCCATGCTGCATGCTGGCGGTAAGGGCGACGTGCAGCTGCGCGTCACCAAGGCCGCTACGGGCGAGCAGTT
CCTGGTCTCGACCCGGCACGCCGTCAGCAAGGACCAGGCGGAGTTTATTTTGGCCGGCAGCGCGCTAAACATGTTGTCGA
AAAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62